ID: 1019527919

View in Genome Browser
Species Human (GRCh38)
Location 7:1489074-1489096
Sequence GCGCTGCCCAGAAGAGCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 5, 3: 18, 4: 213}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019527907_1019527919 14 Left 1019527907 7:1489037-1489059 CCAGCCTGCCCAGTCCCCACTCC 0: 1
1: 0
2: 4
3: 105
4: 1016
Right 1019527919 7:1489074-1489096 GCGCTGCCCAGAAGAGCTGGGGG 0: 1
1: 0
2: 5
3: 18
4: 213
1019527910_1019527919 6 Left 1019527910 7:1489045-1489067 CCCAGTCCCCACTCCTGTCGGCA 0: 1
1: 0
2: 0
3: 11
4: 183
Right 1019527919 7:1489074-1489096 GCGCTGCCCAGAAGAGCTGGGGG 0: 1
1: 0
2: 5
3: 18
4: 213
1019527905_1019527919 16 Left 1019527905 7:1489035-1489057 CCCCAGCCTGCCCAGTCCCCACT 0: 1
1: 0
2: 5
3: 98
4: 967
Right 1019527919 7:1489074-1489096 GCGCTGCCCAGAAGAGCTGGGGG 0: 1
1: 0
2: 5
3: 18
4: 213
1019527914_1019527919 -2 Left 1019527914 7:1489053-1489075 CCACTCCTGTCGGCAGCATAAGC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1019527919 7:1489074-1489096 GCGCTGCCCAGAAGAGCTGGGGG 0: 1
1: 0
2: 5
3: 18
4: 213
1019527903_1019527919 20 Left 1019527903 7:1489031-1489053 CCACCCCCAGCCTGCCCAGTCCC 0: 2
1: 1
2: 17
3: 300
4: 3199
Right 1019527919 7:1489074-1489096 GCGCTGCCCAGAAGAGCTGGGGG 0: 1
1: 0
2: 5
3: 18
4: 213
1019527904_1019527919 17 Left 1019527904 7:1489034-1489056 CCCCCAGCCTGCCCAGTCCCCAC 0: 1
1: 0
2: 9
3: 112
4: 936
Right 1019527919 7:1489074-1489096 GCGCTGCCCAGAAGAGCTGGGGG 0: 1
1: 0
2: 5
3: 18
4: 213
1019527912_1019527919 0 Left 1019527912 7:1489051-1489073 CCCCACTCCTGTCGGCAGCATAA 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1019527919 7:1489074-1489096 GCGCTGCCCAGAAGAGCTGGGGG 0: 1
1: 0
2: 5
3: 18
4: 213
1019527915_1019527919 -7 Left 1019527915 7:1489058-1489080 CCTGTCGGCAGCATAAGCGCTGC 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1019527919 7:1489074-1489096 GCGCTGCCCAGAAGAGCTGGGGG 0: 1
1: 0
2: 5
3: 18
4: 213
1019527911_1019527919 5 Left 1019527911 7:1489046-1489068 CCAGTCCCCACTCCTGTCGGCAG 0: 1
1: 0
2: 0
3: 18
4: 228
Right 1019527919 7:1489074-1489096 GCGCTGCCCAGAAGAGCTGGGGG 0: 1
1: 0
2: 5
3: 18
4: 213
1019527908_1019527919 10 Left 1019527908 7:1489041-1489063 CCTGCCCAGTCCCCACTCCTGTC 0: 1
1: 0
2: 7
3: 83
4: 724
Right 1019527919 7:1489074-1489096 GCGCTGCCCAGAAGAGCTGGGGG 0: 1
1: 0
2: 5
3: 18
4: 213
1019527913_1019527919 -1 Left 1019527913 7:1489052-1489074 CCCACTCCTGTCGGCAGCATAAG 0: 1
1: 0
2: 0
3: 4
4: 63
Right 1019527919 7:1489074-1489096 GCGCTGCCCAGAAGAGCTGGGGG 0: 1
1: 0
2: 5
3: 18
4: 213
1019527906_1019527919 15 Left 1019527906 7:1489036-1489058 CCCAGCCTGCCCAGTCCCCACTC 0: 1
1: 0
2: 2
3: 55
4: 594
Right 1019527919 7:1489074-1489096 GCGCTGCCCAGAAGAGCTGGGGG 0: 1
1: 0
2: 5
3: 18
4: 213

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019527919 Original CRISPR GCGCTGCCCAGAAGAGCTGG GGG Intronic
900098363 1:949696-949718 GAGCTGGGCAGCAGAGCTGGAGG + Intronic
900780221 1:4613172-4613194 GCTCTGCCCAGAAGATCTGATGG - Intergenic
900917031 1:5646329-5646351 GTGGTGCCCAGGTGAGCTGGGGG - Intergenic
901836077 1:11925217-11925239 GCTGAGCCCAGAGGAGCTGGTGG + Exonic
903865244 1:26392955-26392977 AGGCTGCCCAGAAGAGCTAGTGG - Intergenic
904038993 1:27573591-27573613 GCTTTGCCAAAAAGAGCTGGTGG + Intronic
904247354 1:29197193-29197215 GCTCTCCCCAGATGAGCTCGAGG + Intronic
904530471 1:31165357-31165379 GTCCTGCCCAGCAGAGCTGCTGG + Intergenic
905172341 1:36116525-36116547 GCCTTGCCCTGAAGGGCTGGGGG + Intronic
905917666 1:41697047-41697069 GCGTTGCACAGAAGAGACGGAGG + Intronic
906062123 1:42955792-42955814 GTGCTGCCCAGGAGAGATCGTGG + Intronic
906401652 1:45509005-45509027 GCGCTACTCAGAAGAGCAGAAGG + Exonic
910270221 1:85386535-85386557 GTGCTGCCCAGCAAAGCTGTGGG - Intronic
912546932 1:110457584-110457606 ACGCTGCTCAGAAGGGTTGGGGG + Intergenic
914750909 1:150534344-150534366 GCGGGGCTCAGAAGAGCTTGGGG - Intergenic
919746413 1:201011744-201011766 GTGCTAGCCAGCAGAGCTGGAGG - Intronic
920034360 1:203056298-203056320 ACCCAGCCCAGAAGAGGTGGCGG - Intronic
920316073 1:205076446-205076468 TCTCTGCCCAGATGGGCTGGGGG + Exonic
923277034 1:232405497-232405519 GACCTGCACAGCAGAGCTGGGGG + Intronic
924638944 1:245815273-245815295 GCAGAGCCCAGAAGAGCTGTTGG + Intronic
1063818713 10:9809030-9809052 GAGTGGCCCAGAAGAGATGGAGG - Intergenic
1069590792 10:69640708-69640730 AAGCTGCCCAGATGAACTGGTGG - Intergenic
1070055939 10:72934686-72934708 CTGCTGCACAGAAGGGCTGGGGG - Intergenic
1071436816 10:85655107-85655129 GGGTAGCCAAGAAGAGCTGGAGG - Intronic
1071835726 10:89415189-89415211 CCGCTGCCGAGAAGAGCCGTCGG - Intronic
1071934144 10:90508418-90508440 GCACTGCCCAGTGGAGCTGTGGG - Intergenic
1072940573 10:99760145-99760167 GCCATGCCCAGAAAAGCTGCGGG - Intergenic
1073442997 10:103564007-103564029 GGGCTGCCAAGGAGAGATGGGGG - Intronic
1073786306 10:106893823-106893845 CTGCTGGCCCGAAGAGCTGGAGG - Intronic
1074433930 10:113417740-113417762 GCACAGCCCAGAAGCGATGGAGG + Intergenic
1076130394 10:128010086-128010108 GGGCTGCCCAGAAGGACTTGAGG - Intronic
1076626487 10:131824347-131824369 GCCCTGCCCAGCAGCGCAGGTGG - Intergenic
1076898456 10:133325538-133325560 GCGCTGGTCACAGGAGCTGGCGG + Exonic
1077326757 11:1967323-1967345 GGGCTGCCCTGAAGAGCTGTTGG - Intronic
1078934345 11:15938679-15938701 GCTTTTCCCAGAAGAGCTGGCGG + Intergenic
1079903967 11:26222477-26222499 GCACTGCCTAGCAGAGCTGTGGG - Intergenic
1081661225 11:44889553-44889575 GGGCTGCCTAGAAGAGGAGGGGG + Intronic
1082862335 11:57868259-57868281 GCACTGCCCAGTGGAGCTGCAGG - Intergenic
1083048297 11:59755524-59755546 GCGCTTCCCAGGTGAGCTGCCGG - Exonic
1084209548 11:67614707-67614729 GGGCAGCCCAGAGGAGCTGTGGG - Intergenic
1085199999 11:74696206-74696228 GGGCTGCCCGGAAAAGCAGGAGG + Intergenic
1085310016 11:75510660-75510682 GCTCTGCGAAGAAGAGATGGGGG - Intronic
1085524295 11:77155301-77155323 ACGCTGCCCAGGATGGCTGGAGG + Intronic
1087462487 11:98462885-98462907 GCAATGCCCAGCAGAGCTGTGGG + Intergenic
1088577767 11:111288027-111288049 AGGCTGCCCAAAGGAGCTGGTGG - Intergenic
1089657525 11:119961840-119961862 GAGCTACATAGAAGAGCTGGGGG + Intergenic
1090204830 11:124878398-124878420 GAGCTGCCTAGAAGGGCCGGAGG + Exonic
1091037853 11:132249496-132249518 GTGATGCCCAGAAGGACTGGCGG + Intronic
1202809738 11_KI270721v1_random:22503-22525 GGGCTGCCCTGAAGAGCTGTTGG - Intergenic
1094126015 12:27022878-27022900 GCGCAGCCCACAAGTCCTGGCGG - Intronic
1096242086 12:49964985-49965007 GCCCTACCCAGAAAACCTGGTGG - Exonic
1096472601 12:51888830-51888852 TGGCTTCCCAGAACAGCTGGGGG + Intronic
1097268682 12:57760812-57760834 GCCATTCTCAGAAGAGCTGGTGG + Intergenic
1097990609 12:65827893-65827915 GTGCTGCTCAAAAGAGCTGTTGG - Intronic
1099189438 12:79547459-79547481 GCTCCCCACAGAAGAGCTGGTGG - Intergenic
1102945839 12:116987216-116987238 ACACGGTCCAGAAGAGCTGGAGG - Intronic
1102983634 12:117261910-117261932 GCCCTGCCCAGTAGAGCAGAAGG - Intronic
1103488161 12:121296626-121296648 GCGGAGCCCAGGTGAGCTGGCGG - Intronic
1103900207 12:124299896-124299918 GCCCTGCCCGGCAGAGCTGTGGG + Intronic
1106377733 13:29204930-29204952 GCACTACCCAGATGATCTGGGGG + Intronic
1106568671 13:30907502-30907524 GGTCTGCCAAGAAGAGCTTGGGG - Intronic
1108705365 13:52980624-52980646 GGGCTGCCTAGAAGACCTCGTGG + Intergenic
1109059208 13:57591919-57591941 GCTCTGTGCAGAAGAGCAGGTGG - Intergenic
1112568185 13:100569164-100569186 GCACTGCCTAGTAGAGCTGTGGG - Intronic
1113767271 13:112889198-112889220 GCCAAGCCCAGAAGGGCTGGAGG + Intergenic
1113852626 13:113426467-113426489 GCGCTGGAGAGCAGAGCTGGAGG + Intronic
1114383394 14:22232271-22232293 GCACTGCCTAGTAGAGCTGTGGG - Intergenic
1114688243 14:24555375-24555397 GCACTGCCTAGTGGAGCTGGGGG + Intergenic
1117049826 14:51848798-51848820 GGGCTGCCCAGAAGAAGTTGTGG + Intronic
1119167150 14:72503904-72503926 GGGCTGCCCAGAAGAGCTGCAGG - Intronic
1119941120 14:78642698-78642720 GCCCTGCTCAGGAGACCTGGAGG - Intronic
1124955715 15:34359088-34359110 GCGCTGCCCTGAGGAGGAGGGGG + Exonic
1126099581 15:45111426-45111448 GCGCCGCCCACATGAGCAGGGGG + Exonic
1126103946 15:45135611-45135633 GCGCCGCCCACATGAGCAGGGGG - Exonic
1127282045 15:57501160-57501182 GCCCTGCCCAGAAGGGCTCCTGG + Intronic
1127406264 15:58650498-58650520 GATCTGCCCAGAAGAGCTTTTGG - Intronic
1128282602 15:66408846-66408868 CCGCTGCCCAGATGGGGTGGAGG - Intronic
1132769822 16:1555235-1555257 GCGCTAACCAGGAAAGCTGGAGG - Exonic
1134531709 16:14989140-14989162 GCTGAGCCCAGAGGAGCTGGTGG + Intronic
1135104766 16:19639403-19639425 GCCTTGCCCAGAAAAGCTTGTGG + Intronic
1138420122 16:56893331-56893353 GCGGTGCCCAGGAAAGCTGGAGG + Intronic
1140094100 16:71860402-71860424 GCACGGCCAAGAAGAGCCGGCGG - Exonic
1142154013 16:88525021-88525043 GGGCTGGCCAGCAGAGCAGGTGG - Intronic
1142611217 17:1109910-1109932 GGGCTGCTCAGAGGAGGTGGGGG - Intronic
1144147821 17:12415176-12415198 GCGCTGACTAGTAGACCTGGAGG - Intergenic
1145235926 17:21208410-21208432 CCACTGCCAAGAAGAGCGGGAGG + Intronic
1146351935 17:32102341-32102363 GGGGTGCCCAGAAGATCAGGCGG + Intergenic
1149869427 17:60168723-60168745 GGGGTGCCCAGAAGATCGGGTGG + Intronic
1151190156 17:72392522-72392544 GGGCTGCTGAGCAGAGCTGGTGG + Intergenic
1151874066 17:76856604-76856626 GAGCTGCACAGAGGAGCCGGTGG + Intergenic
1153143248 18:1999491-1999513 AAGCTGCCCTGAAGAGCTGCTGG - Intergenic
1153976693 18:10274488-10274510 GAGCTGCCCAGAAGAGCTGCTGG - Intergenic
1154116148 18:11614237-11614259 TCGCTTCCCACAAGAGGTGGTGG - Intergenic
1157726463 18:49968097-49968119 TCCCTGCCCAGAAGAGCTACTGG + Intronic
1160278915 18:77468422-77468444 GAACTGCACAGAAGAGTTGGAGG + Intergenic
1160659585 19:291720-291742 GCGGCGCCCAAAAGAGCGGGTGG + Intergenic
1160826105 19:1081297-1081319 GCTGTGGCCAGAAGACCTGGAGG + Intronic
1161073539 19:2274073-2274095 GCGCTGCCCAAATGAGCTGGGGG - Intronic
1161365657 19:3877903-3877925 CCCCTGCACAAAAGAGCTGGTGG + Intergenic
1161366131 19:3880813-3880835 CCCCTGCACAAAAGAGCTGGCGG + Exonic
1162654204 19:12116580-12116602 GAGCTGCTCTGAACAGCTGGAGG - Intronic
1163056771 19:14725906-14725928 GCACTGCCTAGTGGAGCTGGAGG - Intronic
1164618884 19:29682136-29682158 GGGCTGCCCAGAAGTGCCCGAGG + Intergenic
1167667833 19:50833002-50833024 GGGCCTCCCAGAAGAGGTGGGGG - Intronic
925507252 2:4581965-4581987 GCTCTGCCCAGAAGAGACTGTGG - Intergenic
927468964 2:23358034-23358056 GTGCTGCCCAGAGAAGGTGGAGG + Intergenic
927474711 2:23403877-23403899 GGCCTGGCCAGAAGAGGTGGGGG + Intronic
927641373 2:24847782-24847804 AGGCTGCCCTCAAGAGCTGGTGG - Intronic
928270265 2:29849183-29849205 GCGGTCCCCAGAGCAGCTGGTGG - Intronic
932485586 2:72082394-72082416 GTGCTGCACAGAAGTGCTGACGG - Intergenic
933267175 2:80193597-80193619 GCACTGCCCAGCAGAGATGCTGG - Intronic
934102620 2:88667287-88667309 GGGGTGCCCAGAAGAGCAGGTGG + Intergenic
934687171 2:96329827-96329849 GCACTGCCAAGAAGATCTGCTGG + Exonic
938298202 2:130191698-130191720 GCTCTGCCTACAGGAGCTGGTGG - Intergenic
942244950 2:173999278-173999300 GTGCTGCCCAGGAGTGCTGCTGG - Intergenic
946416757 2:219543725-219543747 GCGCAGCCCAGAGCAGCTGCTGG - Exonic
948027447 2:234789375-234789397 GTCCTGCCCAGAGCAGCTGGGGG - Intergenic
948447033 2:238040794-238040816 ATCCTGCCCAGAAGAGATGGGGG + Intronic
948583345 2:239003120-239003142 ATGGTGCCCAGAAGAGCTGAAGG + Intergenic
948901194 2:240957702-240957724 GGGCTGCCCAGAGGAGCTCCTGG + Intronic
1169354696 20:4896944-4896966 GCTCTGCCCAGGAGGGCTGAGGG - Intronic
1170691792 20:18622857-18622879 GCACTGCCCAGAGGAACTTGCGG - Intronic
1170798255 20:19569146-19569168 GTGCCTCCCAGAAGTGCTGGGGG - Intronic
1174393843 20:50234028-50234050 CGGCTGCCAAGGAGAGCTGGAGG + Intergenic
1175208980 20:57336584-57336606 GCGCTGCCCTGGAGAGGAGGCGG - Intronic
1176201468 20:63862749-63862771 ACGCTGCGAAGAGGAGCTGGAGG + Exonic
1176522145 21:7832368-7832390 GAGCAGCCCAGATCAGCTGGAGG + Intergenic
1178656165 21:34462380-34462402 GAGCAGCCCAGATCAGCTGGAGG + Intergenic
1178978221 21:37238997-37239019 GCGCTGCCCAGAAGAGCACGGGG - Intronic
1179107847 21:38419257-38419279 GGGCTGCCCAGAATGCCTGGTGG + Intronic
1179544330 21:42104362-42104384 CCGCTGCCCAGAAGTGCTGGGGG - Intronic
1180008078 21:45032545-45032567 GCTCTGCCCAGGAGACGTGGCGG - Intergenic
1180958817 22:19753546-19753568 CTGCTGCCCAGAGGAACTGGAGG + Intergenic
1184517240 22:44970264-44970286 GCTCTGCACAGAAGGGCAGGGGG + Intronic
1184614658 22:45629902-45629924 GCGCGGCCCTGAGCAGCTGGAGG + Intergenic
1184738687 22:46414360-46414382 GGGCTGCACAGAGGAGCGGGGGG + Intronic
1185148949 22:49153466-49153488 CCGGTGCCCAGAAGACCTGCGGG + Intergenic
1185358818 22:50392659-50392681 GAGCTGCCCAGAGGACCTGGTGG + Intronic
949230402 3:1743884-1743906 GCACTGCCTAGTAGAGCTGTGGG - Intergenic
950376213 3:12574445-12574467 ACAGTGCCCAGAGGAGCTGGGGG + Intronic
951949711 3:28186315-28186337 GCGCAGACTAGAAGTGCTGGGGG + Intergenic
952226700 3:31383916-31383938 GCCATGCCCTGAAGATCTGGAGG - Intergenic
952991187 3:38832375-38832397 GCACTTCCCTAAAGAGCTGGGGG + Intergenic
953043703 3:39277329-39277351 ACTCTGCCCAGAAGAGCCAGGGG - Intronic
954108407 3:48421224-48421246 GTGCTGCCGAGAGGAGCCGGTGG - Exonic
954574089 3:51665334-51665356 GGGCTGGTCAGAAGAGCTGTAGG - Exonic
954655683 3:52192761-52192783 GCTCTGCCCTGAACAGTTGGAGG - Intergenic
954932334 3:54295157-54295179 GCTATGCCGAGAAGAGTTGGGGG + Intronic
954992518 3:54853737-54853759 GGGCTTCCCAGAGGAGGTGGGGG + Intronic
959070052 3:101693704-101693726 GCCCTGCCCTGTAGTGCTGGGGG - Intergenic
959125835 3:102289954-102289976 GAGCCACCCAGAAGAGCTAGTGG + Intronic
959886979 3:111514453-111514475 GAGATGCCCTTAAGAGCTGGAGG - Intronic
960167489 3:114420218-114420240 GGGAAGCCCAGGAGAGCTGGGGG + Intronic
961454532 3:127017487-127017509 GCGCAGCCCACCAGAGCTGGGGG + Exonic
961812136 3:129528004-129528026 GCCCTGCCCAGAGGAGCTCAGGG - Intergenic
962785323 3:138763085-138763107 GAGCTGCCAACAAAAGCTGGAGG + Intronic
962825357 3:139095907-139095929 GGGCAGCCCAGATGAGGTGGGGG + Intronic
963008887 3:140751122-140751144 GGGAGGCCCAGAGGAGCTGGTGG + Intergenic
967164955 3:186772496-186772518 CCGCCGCCCACAAGGGCTGGGGG - Intergenic
967710052 3:192696429-192696451 GAGGAGCCCAGAACAGCTGGTGG + Intronic
968904339 4:3444616-3444638 GGGCTGCTCAGACAAGCTGGGGG - Exonic
971143058 4:23945962-23945984 GTGCAACCCAGAACAGCTGGAGG + Intergenic
977554697 4:98477074-98477096 GCTCTGCCCAGAGGATCTGTAGG + Intronic
981964582 4:150584039-150584061 GCGCTGCCAAGCAGACCTGGAGG + Exonic
985639156 5:1055450-1055472 GCACTGCCCAGAAGAGGTCAGGG + Intronic
985670606 5:1204675-1204697 GCCCTGTGCAGAGGAGCTGGGGG - Intronic
985748463 5:1661089-1661111 GCGCTGGCCAGAAGCGCAGGTGG + Intergenic
985887085 5:2688061-2688083 GAGCTGACCAGTGGAGCTGGAGG - Intergenic
987137898 5:14916956-14916978 GTGCTGCCCAGAATAGGTGGAGG + Intergenic
988903379 5:35758561-35758583 TAGCAACCCAGAAGAGCTGGTGG - Intronic
989719302 5:44505138-44505160 GCAATGCCCAGAAGAACTGAGGG + Intergenic
991983483 5:72258203-72258225 GCTCTGCCCAGGAAAGCTGCTGG + Intronic
994363471 5:98883203-98883225 TTGCTGTCCACAAGAGCTGGAGG - Exonic
996045635 5:118869959-118869981 CCGCTTCACACAAGAGCTGGTGG + Intronic
996730801 5:126715679-126715701 GAGCTGCTCAGAACAGCTGAGGG + Intergenic
998135735 5:139673517-139673539 GTGCTCCCCAAAACAGCTGGAGG - Intronic
998576631 5:143324128-143324150 GCACTGCCCAGTGGAGCTGTGGG - Intronic
998776509 5:145609684-145609706 GTGCTTCCCAGAAGAACAGGAGG + Intronic
1000262361 5:159600162-159600184 GTACTGCCCAGCAGAGCTGTGGG - Intergenic
1000269774 5:159672915-159672937 GCACTGCCTAGTAGAGCTGTGGG + Intergenic
1000345704 5:160312083-160312105 GCGCCGCTCAGAGGAGCTGGAGG + Intronic
1002213218 5:177610498-177610520 GGGCTGCCCAGAAGCCTTGGTGG - Intergenic
1004624068 6:17358282-17358304 GCACTGCCTAGTAGAGCTGTGGG + Intergenic
1006090411 6:31625488-31625510 GCGTGGCCCTGATGAGCTGGAGG + Exonic
1006529082 6:34634919-34634941 GCACTGTCCAAAAGAGCTGGTGG + Intronic
1007498677 6:42279368-42279390 GCCCTGCCCAGGACAGCTGCAGG - Intronic
1009569207 6:65360395-65360417 GTGCTACCTAGAAGAGCTAGAGG - Intronic
1011055766 6:83201904-83201926 GCGCTGCCTTGAGCAGCTGGGGG - Intergenic
1016832093 6:148444339-148444361 GCTCTGACCAGAAGAGGGGGAGG + Intronic
1017282226 6:152637135-152637157 CCGGTGCCTGGAAGAGCTGGGGG + Intronic
1017543441 6:155426565-155426587 GAGCTGCCCAGCAGAGATGTGGG + Intronic
1018690522 6:166340592-166340614 GCACAGCTCAGAAGAGCTGCTGG - Intronic
1019409075 7:898801-898823 GGGCTGCCCTGAGGAGCAGGTGG + Exonic
1019527919 7:1489074-1489096 GCGCTGCCCAGAAGAGCTGGGGG + Intronic
1023557382 7:41437417-41437439 GCTCTGCCCAGCAGAGATGGTGG - Intergenic
1023866051 7:44238940-44238962 GCACAGCCCAGAGGAGCAGGTGG + Intronic
1024548059 7:50538872-50538894 GCCCTGCCCAGCAGAGAGGGAGG + Intronic
1024877038 7:54037581-54037603 GCACTGCCTAGTAGAGCTGTGGG - Intergenic
1025929447 7:65982344-65982366 GCGCTGCCCGGTAGGGCTTGTGG + Intergenic
1027465294 7:78507483-78507505 ACTCTGCCCAGAAGAGGTGCAGG - Intronic
1030841511 7:114359425-114359447 GTACTGCCTAGAAGAGCTGTGGG + Intronic
1030984241 7:116222350-116222372 AGGCTGCCCAGAGGAGCAGGAGG - Intronic
1032474453 7:132202697-132202719 GCCCTGCCCAGGAGAGCCAGTGG - Exonic
1033607711 7:142939636-142939658 ACACTGCCCTGCAGAGCTGGGGG - Exonic
1033740733 7:144273929-144273951 GGGCTGGGCAGAGGAGCTGGGGG - Intergenic
1033753173 7:144375684-144375706 GGGCTGGGCAGAGGAGCTGGGGG + Intronic
1034538955 7:151743987-151744009 GCACTACACAGCAGAGCTGGGGG + Intronic
1035308224 7:157947090-157947112 GAGCTGCCCTGCAGAGCTGAAGG + Intronic
1035574264 8:695137-695159 GAGCAGCCCAGAGGAGCTGAGGG - Intronic
1036631492 8:10519004-10519026 GCAATTGCCAGAAGAGCTGGAGG + Intergenic
1037582321 8:20253009-20253031 GCGCTGCAGGGACGAGCTGGAGG - Exonic
1038779462 8:30557702-30557724 GAGCAGCCCAGAAGTGCTGCTGG - Intronic
1039581685 8:38671944-38671966 GTGCAGCCCTGCAGAGCTGGAGG - Intergenic
1045550506 8:103167470-103167492 GCATAGCCCAGTAGAGCTGGCGG + Intronic
1046871242 8:119208176-119208198 GCGCTGGCCAGCGGAGCAGGAGG + Intronic
1047509659 8:125506426-125506448 GGGCAGCCCAGGAGAGCTGAGGG - Intergenic
1047940481 8:129823793-129823815 GCACTGCCTAGTAGAGCTGTGGG + Intergenic
1049585850 8:143432086-143432108 GCTCTGCCCAGAGGAGTGGGAGG - Intergenic
1049777803 8:144414495-144414517 GCGCTGCTCACCAGAGCTGCAGG + Intronic
1053034129 9:34810096-34810118 GCGCTGCCCAGCGGAGCTCGAGG - Intergenic
1053202628 9:36163310-36163332 GGGCTGCCTAGCAGAGGTGGGGG - Exonic
1053409514 9:37906483-37906505 GCTCTGCCCTCATGAGCTGGCGG - Intronic
1055232068 9:74077977-74077999 GTGGTGCCCTGAAGAGCTGCAGG + Intergenic
1056834073 9:89940338-89940360 GTGCTACCCAGAGGAGATGGAGG - Intergenic
1057855861 9:98600269-98600291 GCTCTGCCCAGCAGAGAAGGAGG - Intronic
1058754320 9:108070483-108070505 AAGCTGCCCAGAAGAGGTGCTGG - Intergenic
1060171033 9:121461275-121461297 GCAGTGCTCAGAAGGGCTGGTGG - Intergenic
1062344830 9:136109838-136109860 ACGCTGCCCAGCTGGGCTGGGGG + Intergenic
1062549028 9:137077586-137077608 GCTCGGCCCAGAAGCGCAGGAGG - Exonic
1187158611 X:16744231-16744253 GTGGAGCCCAGAAGAGCTGTTGG - Intronic
1187412448 X:19063031-19063053 GTACCGCCCAGGAGAGCTGGAGG + Intronic
1190221371 X:48514399-48514421 GTGCTGCCTAGAGGAGCTGCAGG + Intronic
1190326397 X:49209613-49209635 GCCCTGCCCCGAAGACCTGAAGG + Exonic
1192149882 X:68705618-68705640 GGGCTGCCCAGAGGGGCCGGAGG + Intronic
1196081493 X:111637638-111637660 GCAATGCCCAGAAGAGCTGTGGG + Intergenic
1198267482 X:135022605-135022627 GCTCTGCCCAGAAGGCCTGGAGG + Intergenic
1200832847 Y:7704398-7704420 GGAGTACCCAGAAGAGCTGGAGG - Intergenic