ID: 1019528986

View in Genome Browser
Species Human (GRCh38)
Location 7:1494355-1494377
Sequence AGCCCCAGGCGGGGCTGGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019528973_1019528986 14 Left 1019528973 7:1494318-1494340 CCCAGGGCACGAGGTGGGGGCAG 0: 1
1: 0
2: 1
3: 38
4: 369
Right 1019528986 7:1494355-1494377 AGCCCCAGGCGGGGCTGGAGGGG No data
1019528974_1019528986 13 Left 1019528974 7:1494319-1494341 CCAGGGCACGAGGTGGGGGCAGG 0: 1
1: 0
2: 2
3: 57
4: 525
Right 1019528986 7:1494355-1494377 AGCCCCAGGCGGGGCTGGAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019528986 Original CRISPR AGCCCCAGGCGGGGCTGGAG GGG Intronic
No off target data available for this crispr