ID: 1019533101

View in Genome Browser
Species Human (GRCh38)
Location 7:1513410-1513432
Sequence TCTGAATGACAAGTGGCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019533097_1019533101 3 Left 1019533097 7:1513384-1513406 CCAGGGATTGAGAGATTCCGCGT No data
Right 1019533101 7:1513410-1513432 TCTGAATGACAAGTGGCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019533101 Original CRISPR TCTGAATGACAAGTGGCCAC AGG Intergenic
No off target data available for this crispr