ID: 1019534858

View in Genome Browser
Species Human (GRCh38)
Location 7:1523607-1523629
Sequence GGAAGTTCAGCGTGGCTCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019534858_1019534864 -8 Left 1019534858 7:1523607-1523629 CCGGGGAGCCACGCTGAACTTCC No data
Right 1019534864 7:1523622-1523644 GAACTTCCCGAGCTCGGGGTGGG No data
1019534858_1019534875 29 Left 1019534858 7:1523607-1523629 CCGGGGAGCCACGCTGAACTTCC No data
Right 1019534875 7:1523659-1523681 CCTGAAGTCCAGCCTGTTCCGGG No data
1019534858_1019534863 -9 Left 1019534858 7:1523607-1523629 CCGGGGAGCCACGCTGAACTTCC No data
Right 1019534863 7:1523621-1523643 TGAACTTCCCGAGCTCGGGGTGG No data
1019534858_1019534873 28 Left 1019534858 7:1523607-1523629 CCGGGGAGCCACGCTGAACTTCC No data
Right 1019534873 7:1523658-1523680 TCCTGAAGTCCAGCCTGTTCCGG No data
1019534858_1019534868 2 Left 1019534858 7:1523607-1523629 CCGGGGAGCCACGCTGAACTTCC No data
Right 1019534868 7:1523632-1523654 AGCTCGGGGTGGGATGTGGCCGG No data
1019534858_1019534871 5 Left 1019534858 7:1523607-1523629 CCGGGGAGCCACGCTGAACTTCC No data
Right 1019534871 7:1523635-1523657 TCGGGGTGGGATGTGGCCGGGGG No data
1019534858_1019534866 -2 Left 1019534858 7:1523607-1523629 CCGGGGAGCCACGCTGAACTTCC No data
Right 1019534866 7:1523628-1523650 CCCGAGCTCGGGGTGGGATGTGG No data
1019534858_1019534869 3 Left 1019534858 7:1523607-1523629 CCGGGGAGCCACGCTGAACTTCC No data
Right 1019534869 7:1523633-1523655 GCTCGGGGTGGGATGTGGCCGGG No data
1019534858_1019534870 4 Left 1019534858 7:1523607-1523629 CCGGGGAGCCACGCTGAACTTCC No data
Right 1019534870 7:1523634-1523656 CTCGGGGTGGGATGTGGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019534858 Original CRISPR GGAAGTTCAGCGTGGCTCCC CGG (reversed) Intergenic
No off target data available for this crispr