ID: 1019534859

View in Genome Browser
Species Human (GRCh38)
Location 7:1523615-1523637
Sequence CGAGCTCGGGAAGTTCAGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019534859_1019534871 -3 Left 1019534859 7:1523615-1523637 CCACGCTGAACTTCCCGAGCTCG No data
Right 1019534871 7:1523635-1523657 TCGGGGTGGGATGTGGCCGGGGG No data
1019534859_1019534875 21 Left 1019534859 7:1523615-1523637 CCACGCTGAACTTCCCGAGCTCG No data
Right 1019534875 7:1523659-1523681 CCTGAAGTCCAGCCTGTTCCGGG No data
1019534859_1019534873 20 Left 1019534859 7:1523615-1523637 CCACGCTGAACTTCCCGAGCTCG No data
Right 1019534873 7:1523658-1523680 TCCTGAAGTCCAGCCTGTTCCGG No data
1019534859_1019534868 -6 Left 1019534859 7:1523615-1523637 CCACGCTGAACTTCCCGAGCTCG No data
Right 1019534868 7:1523632-1523654 AGCTCGGGGTGGGATGTGGCCGG No data
1019534859_1019534869 -5 Left 1019534859 7:1523615-1523637 CCACGCTGAACTTCCCGAGCTCG No data
Right 1019534869 7:1523633-1523655 GCTCGGGGTGGGATGTGGCCGGG No data
1019534859_1019534866 -10 Left 1019534859 7:1523615-1523637 CCACGCTGAACTTCCCGAGCTCG No data
Right 1019534866 7:1523628-1523650 CCCGAGCTCGGGGTGGGATGTGG 0: 1
1: 0
2: 0
3: 19
4: 204
1019534859_1019534870 -4 Left 1019534859 7:1523615-1523637 CCACGCTGAACTTCCCGAGCTCG No data
Right 1019534870 7:1523634-1523656 CTCGGGGTGGGATGTGGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019534859 Original CRISPR CGAGCTCGGGAAGTTCAGCG TGG (reversed) Intergenic