ID: 1019534867

View in Genome Browser
Species Human (GRCh38)
Location 7:1523629-1523651
Sequence GCCACATCCCACCCCGAGCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019534867_1019534875 7 Left 1019534867 7:1523629-1523651 CCGAGCTCGGGGTGGGATGTGGC No data
Right 1019534875 7:1523659-1523681 CCTGAAGTCCAGCCTGTTCCGGG No data
1019534867_1019534880 29 Left 1019534867 7:1523629-1523651 CCGAGCTCGGGGTGGGATGTGGC No data
Right 1019534880 7:1523681-1523703 GCTCCAGTCTCCACTTTTCTGGG No data
1019534867_1019534879 28 Left 1019534867 7:1523629-1523651 CCGAGCTCGGGGTGGGATGTGGC No data
Right 1019534879 7:1523680-1523702 GGCTCCAGTCTCCACTTTTCTGG No data
1019534867_1019534873 6 Left 1019534867 7:1523629-1523651 CCGAGCTCGGGGTGGGATGTGGC No data
Right 1019534873 7:1523658-1523680 TCCTGAAGTCCAGCCTGTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019534867 Original CRISPR GCCACATCCCACCCCGAGCT CGG (reversed) Intergenic
No off target data available for this crispr