ID: 1019534871

View in Genome Browser
Species Human (GRCh38)
Location 7:1523635-1523657
Sequence TCGGGGTGGGATGTGGCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019534853_1019534871 18 Left 1019534853 7:1523594-1523616 CCCCCTTTAGCTCCCGGGGAGCC No data
Right 1019534871 7:1523635-1523657 TCGGGGTGGGATGTGGCCGGGGG No data
1019534854_1019534871 17 Left 1019534854 7:1523595-1523617 CCCCTTTAGCTCCCGGGGAGCCA No data
Right 1019534871 7:1523635-1523657 TCGGGGTGGGATGTGGCCGGGGG No data
1019534855_1019534871 16 Left 1019534855 7:1523596-1523618 CCCTTTAGCTCCCGGGGAGCCAC No data
Right 1019534871 7:1523635-1523657 TCGGGGTGGGATGTGGCCGGGGG No data
1019534857_1019534871 6 Left 1019534857 7:1523606-1523628 CCCGGGGAGCCACGCTGAACTTC No data
Right 1019534871 7:1523635-1523657 TCGGGGTGGGATGTGGCCGGGGG No data
1019534856_1019534871 15 Left 1019534856 7:1523597-1523619 CCTTTAGCTCCCGGGGAGCCACG No data
Right 1019534871 7:1523635-1523657 TCGGGGTGGGATGTGGCCGGGGG No data
1019534858_1019534871 5 Left 1019534858 7:1523607-1523629 CCGGGGAGCCACGCTGAACTTCC No data
Right 1019534871 7:1523635-1523657 TCGGGGTGGGATGTGGCCGGGGG No data
1019534859_1019534871 -3 Left 1019534859 7:1523615-1523637 CCACGCTGAACTTCCCGAGCTCG No data
Right 1019534871 7:1523635-1523657 TCGGGGTGGGATGTGGCCGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019534871 Original CRISPR TCGGGGTGGGATGTGGCCGG GGG Intergenic