ID: 1019534873

View in Genome Browser
Species Human (GRCh38)
Location 7:1523658-1523680
Sequence TCCTGAAGTCCAGCCTGTTC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019534858_1019534873 28 Left 1019534858 7:1523607-1523629 CCGGGGAGCCACGCTGAACTTCC No data
Right 1019534873 7:1523658-1523680 TCCTGAAGTCCAGCCTGTTCCGG No data
1019534857_1019534873 29 Left 1019534857 7:1523606-1523628 CCCGGGGAGCCACGCTGAACTTC No data
Right 1019534873 7:1523658-1523680 TCCTGAAGTCCAGCCTGTTCCGG No data
1019534859_1019534873 20 Left 1019534859 7:1523615-1523637 CCACGCTGAACTTCCCGAGCTCG No data
Right 1019534873 7:1523658-1523680 TCCTGAAGTCCAGCCTGTTCCGG No data
1019534865_1019534873 7 Left 1019534865 7:1523628-1523650 CCCGAGCTCGGGGTGGGATGTGG No data
Right 1019534873 7:1523658-1523680 TCCTGAAGTCCAGCCTGTTCCGG No data
1019534867_1019534873 6 Left 1019534867 7:1523629-1523651 CCGAGCTCGGGGTGGGATGTGGC No data
Right 1019534873 7:1523658-1523680 TCCTGAAGTCCAGCCTGTTCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019534873 Original CRISPR TCCTGAAGTCCAGCCTGTTC CGG Intergenic