ID: 1019534879

View in Genome Browser
Species Human (GRCh38)
Location 7:1523680-1523702
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 185}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019534874_1019534879 -2 Left 1019534874 7:1523659-1523681 CCTGAAGTCCAGCCTGTTCCGGG No data
Right 1019534879 7:1523680-1523702 GGCTCCAGTCTCCACTTTTCTGG 0: 1
1: 0
2: 0
3: 4
4: 185
1019534865_1019534879 29 Left 1019534865 7:1523628-1523650 CCCGAGCTCGGGGTGGGATGTGG No data
Right 1019534879 7:1523680-1523702 GGCTCCAGTCTCCACTTTTCTGG 0: 1
1: 0
2: 0
3: 4
4: 185
1019534876_1019534879 -10 Left 1019534876 7:1523667-1523689 CCAGCCTGTTCCGGGCTCCAGTC No data
Right 1019534879 7:1523680-1523702 GGCTCCAGTCTCCACTTTTCTGG 0: 1
1: 0
2: 0
3: 4
4: 185
1019534872_1019534879 6 Left 1019534872 7:1523651-1523673 CCGGGGGTCCTGAAGTCCAGCCT No data
Right 1019534879 7:1523680-1523702 GGCTCCAGTCTCCACTTTTCTGG 0: 1
1: 0
2: 0
3: 4
4: 185
1019534867_1019534879 28 Left 1019534867 7:1523629-1523651 CCGAGCTCGGGGTGGGATGTGGC No data
Right 1019534879 7:1523680-1523702 GGCTCCAGTCTCCACTTTTCTGG 0: 1
1: 0
2: 0
3: 4
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019534879 Original CRISPR GGCTCCAGTCTCCACTTTTC TGG Intergenic