ID: 1019534880

View in Genome Browser
Species Human (GRCh38)
Location 7:1523681-1523703
Sequence GCTCCAGTCTCCACTTTTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019534876_1019534880 -9 Left 1019534876 7:1523667-1523689 CCAGCCTGTTCCGGGCTCCAGTC No data
Right 1019534880 7:1523681-1523703 GCTCCAGTCTCCACTTTTCTGGG No data
1019534874_1019534880 -1 Left 1019534874 7:1523659-1523681 CCTGAAGTCCAGCCTGTTCCGGG No data
Right 1019534880 7:1523681-1523703 GCTCCAGTCTCCACTTTTCTGGG No data
1019534872_1019534880 7 Left 1019534872 7:1523651-1523673 CCGGGGGTCCTGAAGTCCAGCCT No data
Right 1019534880 7:1523681-1523703 GCTCCAGTCTCCACTTTTCTGGG No data
1019534865_1019534880 30 Left 1019534865 7:1523628-1523650 CCCGAGCTCGGGGTGGGATGTGG No data
Right 1019534880 7:1523681-1523703 GCTCCAGTCTCCACTTTTCTGGG No data
1019534867_1019534880 29 Left 1019534867 7:1523629-1523651 CCGAGCTCGGGGTGGGATGTGGC No data
Right 1019534880 7:1523681-1523703 GCTCCAGTCTCCACTTTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019534880 Original CRISPR GCTCCAGTCTCCACTTTTCT GGG Intergenic