ID: 1019538730

View in Genome Browser
Species Human (GRCh38)
Location 7:1541912-1541934
Sequence GGCCCCAGGCACCACCTTGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 311
Summary {0: 1, 1: 0, 2: 1, 3: 30, 4: 279}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019538730_1019538733 -8 Left 1019538730 7:1541912-1541934 CCTGCAAGGTGGTGCCTGGGGCC 0: 1
1: 0
2: 1
3: 30
4: 279
Right 1019538733 7:1541927-1541949 CTGGGGCCCTGGCTCCTTCTCGG 0: 1
1: 0
2: 3
3: 48
4: 417

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019538730 Original CRISPR GGCCCCAGGCACCACCTTGC AGG (reversed) Exonic
900383181 1:2395476-2395498 GGCCCCAGGAGCAGCCTTGCTGG - Intronic
900620512 1:3584872-3584894 GTCCCCAGGCACCTCCGGGCTGG - Intronic
901394583 1:8971760-8971782 GGCCCCAGACCCCAGCGTGCTGG + Intronic
901720189 1:11191152-11191174 GACCCCAAGAACCTCCTTGCAGG - Intronic
902396561 1:16135105-16135127 GGCCCCAGACACCACCTACCTGG - Exonic
902620287 1:17646824-17646846 GGCCACTGGCTCCACCGTGCTGG - Intronic
903217840 1:21852888-21852910 GCCCCCCGGGACCACCTTGCTGG - Intronic
903297839 1:22356599-22356621 GGCCAGAGGCACCTGCTTGCTGG + Intergenic
903339236 1:22643778-22643800 TGCCCCTGGCACCACATTTCAGG - Intronic
904400354 1:30252650-30252672 GGGCCCATGCTCCACCTGGCAGG + Intergenic
904432730 1:30475512-30475534 GGACCCAGTCCCCACCTTCCAGG + Intergenic
904837333 1:33347869-33347891 GGCCCCAGTTCCCGCCTTGCAGG + Intronic
905297164 1:36961540-36961562 GGCCCCAGGCACAGCCCTGGGGG + Intronic
906719206 1:47993569-47993591 GGTCCCAGGCAACTCCTTGTTGG + Intronic
909739227 1:79007194-79007216 GTGCTCAGGCCCCACCTTGCTGG + Intergenic
910378959 1:86604959-86604981 GGCCCCAGGCTTTACTTTGCTGG + Intergenic
910436952 1:87215121-87215143 GCCCCAAGTCACTACCTTGCTGG + Intergenic
912460390 1:109827028-109827050 GGCCCCAGGCACAGCCGTGGTGG + Intergenic
912467333 1:109883085-109883107 GGCCCCAGGCCCCTCCCTGCTGG + Intergenic
915349241 1:155214190-155214212 AGCCCCTGGCACCACCTAGAGGG + Intergenic
915352428 1:155234817-155234839 AGCCCCTGGCACCACCTAGAGGG + Exonic
915508774 1:156374279-156374301 GGCACCAGGCACCAGTTTCCTGG - Intronic
917099504 1:171431211-171431233 GGCCCCTGGCAGCATCTTGGGGG + Intergenic
918041747 1:180917876-180917898 GGCCTCGGGCACCTCCTTGCAGG + Exonic
918194297 1:182207205-182207227 GCCCCCTTGCCCCACCTTGCTGG - Intergenic
920172640 1:204081501-204081523 GGCCCCACGGACCCCCTGGCGGG + Intronic
920604846 1:207371541-207371563 GGCCTCAGCCACCTCCCTGCGGG - Intergenic
921335539 1:214082005-214082027 AGCCCCAGCCAACACCTTGACGG + Intergenic
924317228 1:242810969-242810991 GGCACCTCCCACCACCTTGCAGG + Intergenic
1062768071 10:80482-80504 GCACCCAGGCATCTCCTTGCTGG + Intergenic
1066349453 10:34624028-34624050 GGTCCCAGGCACCAGCTGCCTGG + Intronic
1067169540 10:43895316-43895338 TGCCCCAGGCACCACCCTCCAGG - Intergenic
1069625917 10:69867559-69867581 GGCCCCAGGCTCAGCCCTGCTGG - Intronic
1070103890 10:73414049-73414071 CGCCCCCGGCTCCATCTTGCGGG - Exonic
1070555618 10:77525566-77525588 GGCCCCAGGCACCAGCTGTGTGG - Intronic
1071960340 10:90803875-90803897 GGCCACAGGCACAGGCTTGCAGG - Intronic
1072620614 10:97076674-97076696 GGCCCAAGGCAGCACAATGCAGG - Intronic
1072715302 10:97748205-97748227 GGCCCCAGGCTCCACTTCCCAGG + Intronic
1072720562 10:97778373-97778395 GTCCCCAGGCATCACCCTCCTGG + Intergenic
1074775287 10:116763577-116763599 GTCCCCTGGCCCCACCCTGCTGG - Intergenic
1075213114 10:120508584-120508606 GGCACCATGCACCACACTGCCGG - Intronic
1075712056 10:124536099-124536121 GGCCCCAGCCCCCACCTTACAGG - Intronic
1075889548 10:125934910-125934932 GGCCCATGGCACCATCCTGCAGG - Intronic
1076530336 10:131140660-131140682 GACCCCAGAGAGCACCTTGCAGG + Intronic
1076802059 10:132835409-132835431 GGCCAGACGCATCACCTTGCAGG + Exonic
1077032748 11:477045-477067 GCCCACAGGGACCACCTTTCTGG - Intronic
1077141135 11:1025411-1025433 GGCCCCTGGCACAGCCGTGCTGG + Intronic
1077144693 11:1039723-1039745 GGCCCCGGGCCCCAGCTTCCCGG + Intergenic
1077498410 11:2897726-2897748 CGCCCCAGGCAAAACCTTGTTGG + Intronic
1077510692 11:2960298-2960320 AGCCCCAGCCCCCACCCTGCTGG + Intronic
1077907583 11:6546126-6546148 GCAGCCAGGCACCACCCTGCAGG - Exonic
1079242793 11:18732577-18732599 TGCCCCAGGCCTCACCTTGAGGG + Exonic
1079981289 11:27154022-27154044 ATCCCCAGGCACCACCTGGGAGG + Intergenic
1081884485 11:46483307-46483329 GGCCCCAGTCACCTATTTGCAGG + Intronic
1082785004 11:57311789-57311811 GGGCCCAGCCACCAACTTGCTGG + Intronic
1083173497 11:60936106-60936128 GGCCTCTGGCACCGCCTGGCTGG + Exonic
1083322815 11:61857636-61857658 GGCCCCAGGCATCTCCTCCCTGG + Intronic
1085026562 11:73239909-73239931 AGCCCCACCCTCCACCTTGCAGG - Intergenic
1085793090 11:79512943-79512965 GCCCACAGGCACCACCATGTAGG + Intergenic
1088469289 11:110176498-110176520 GTCCCCAGGCACCCCGTGGCTGG - Intronic
1089736221 11:120551912-120551934 CTCCCCAGGCACCACCCTCCAGG - Intronic
1089753613 11:120669585-120669607 GTCCCCAGGCCCCATCTTACTGG + Intronic
1091332067 11:134737696-134737718 TGCCCCAGGTCCCACCTTGGAGG + Intergenic
1091333107 11:134746061-134746083 GGTCCTAGGCACCAGCATGCTGG - Intergenic
1091800230 12:3320437-3320459 GGGCCCAGGCTCCACCAAGCAGG - Intergenic
1092625223 12:10319747-10319769 GCCCCCAGCCAACACCTTGACGG + Intergenic
1094858434 12:34431679-34431701 GGGCCCAGGGACCAACTTGAGGG - Intergenic
1095090507 12:38099812-38099834 TGGCCCAGCCACCATCTTGCAGG - Intergenic
1095412180 12:41936386-41936408 GGCCCCAGGGAACACAGTGCTGG - Intergenic
1096184933 12:49572685-49572707 GGCCCCAGGCTCCATCTTCTGGG + Intronic
1096214516 12:49791977-49791999 CGCCCCAGGGCCCACCTTTCGGG - Exonic
1098041939 12:66361634-66361656 TGCCCCAGCCACCACCAAGCTGG + Intronic
1101970446 12:109309104-109309126 GGCTCCAGGTACCGCCTTGCAGG - Exonic
1104859923 12:131918527-131918549 GGGCCCAGGCACCAGGTGGCGGG - Exonic
1105688499 13:22811235-22811257 GGGCACAGGCACCAGCTTGAAGG + Intergenic
1112086187 13:96034527-96034549 TGCCCCACTCACCACATTGCAGG + Intronic
1112167689 13:96937061-96937083 AGCCCCAGCCACCACCTTGATGG - Intergenic
1112326811 13:98447023-98447045 GGCCTCAGCCAACACCGTGCAGG - Intronic
1113909265 13:113834503-113834525 GGCCCCCGGAACCACCGTGAAGG + Intronic
1118006568 14:61568837-61568859 TGCCCCAGGCACCAGCCTGGGGG - Intronic
1118558897 14:67056859-67056881 GGCCTCAGCCGCCTCCTTGCGGG - Intronic
1119341997 14:73886984-73887006 GGCCCCAGGCCCCAAGTAGCCGG - Intronic
1120088675 14:80305940-80305962 AGCCCAAGCCACCACCTTGAAGG - Intronic
1121703018 14:95970508-95970530 GGGCCCAGACATCACCTTCCTGG - Intergenic
1122576614 14:102746924-102746946 GGCCCCAGGCAGCTGCCTGCTGG + Intergenic
1122986112 14:105212450-105212472 GGCACCAGGCAGCTCCTTGAGGG - Intronic
1123714111 15:23013948-23013970 GGGCCCAGGCTCCACATAGCTGG - Intronic
1124377315 15:29136351-29136373 GGCCCCAGGCCTCACCTGGCTGG + Exonic
1124622080 15:31279512-31279534 GGCCACAGTCAGCAGCTTGCAGG - Intergenic
1124687825 15:31797565-31797587 GGGCCCAGGCCCCACCATGCAGG + Intronic
1125565286 15:40672974-40672996 GGCCCCAGGCATTTCTTTGCTGG + Intergenic
1127470316 15:59284123-59284145 TGCCCCAGGCACCACCCTGGTGG - Intronic
1127875383 15:63107254-63107276 TGCCCCAGCCACCAAGTTGCTGG + Intergenic
1128682131 15:69659926-69659948 GGCCCCAGGCATCACATTCCTGG - Intergenic
1132456967 16:29431-29453 GCACCCAGGCAACTCCTTGCTGG + Intergenic
1132473906 16:122861-122883 CGCCCCACCCACCTCCTTGCTGG + Intronic
1132500757 16:283627-283649 TGCCAGAGTCACCACCTTGCCGG + Intronic
1132574972 16:660083-660105 GGCCCCACGCACCACCTACCTGG + Exonic
1132852217 16:2029912-2029934 TGCCCCAGGGACCATCTTGTTGG + Intronic
1132871781 16:2118618-2118640 GGGCCCAGGTCCCACCTGGCTGG + Intronic
1132941773 16:2512126-2512148 GGCCCCAGGCACAGCCTTCCTGG + Intronic
1133219151 16:4311487-4311509 GGCCCTGGGCAGGACCTTGCAGG + Intergenic
1133347655 16:5081215-5081237 GGCCCCTGGGGCCACCTGGCAGG - Intronic
1134520746 16:14918277-14918299 GGGCCCAGGTCCCACCTGGCTGG - Intronic
1134550829 16:15137696-15137718 GGGCCCAGGTCCCACCTGGCTGG + Intronic
1134607660 16:15583715-15583737 GGCCCCAGGCAACTGCCTGCAGG - Intronic
1134708418 16:16316928-16316950 GGGCCCAGGTCCCACCTGGCTGG - Intergenic
1134715633 16:16356961-16356983 GGGCCCAGGTCCCACCTGGCTGG - Intergenic
1134951184 16:18351717-18351739 GGGCCCAGGTCCCACCTGGCTGG + Intergenic
1134959124 16:18395198-18395220 GGGCCCAGGTCCCACCTGGCTGG + Intergenic
1135503831 16:23019520-23019542 GGCCACAGGAAACACCTTTCAGG - Intergenic
1136228790 16:28875363-28875385 AGCCCCAGGCCCCTCCTTGTTGG - Intergenic
1136716542 16:32287409-32287431 GTCCCCGGGCACCTCCTTGTGGG - Intergenic
1136834930 16:33493687-33493709 GTCCCCGGGCACCTCCTTGTGGG - Intergenic
1139949212 16:70661019-70661041 GCCCCCAGGCAGCCCCTAGCAGG + Intergenic
1140840291 16:78832138-78832160 AGCCCCAGCCAACAGCTTGCTGG - Intronic
1141127287 16:81409571-81409593 GGGCCCAGGCATCTCCTTCCTGG + Intergenic
1141319050 16:82989499-82989521 GCCTTCAGGCACCACTTTGCTGG - Intronic
1203009873 16_KI270728v1_random:230345-230367 GTCCCCGGGCACCTCCTTGTGGG + Intergenic
1142470715 17:161848-161870 GGCCCCAGGAAGCACCTTCAGGG + Intronic
1143119811 17:4599676-4599698 GGCCCCATGCCCCAGCCTGCAGG + Intronic
1143581987 17:7833097-7833119 GGTCCCAGCCAGCACCTTCCAGG - Exonic
1143585093 17:7846959-7846981 GGCCCCAGGCATCTCCATGCAGG - Exonic
1144675264 17:17157949-17157971 GGGCCCAGGCCTCACCTGGCAGG + Intronic
1146637798 17:34518992-34519014 GGGCCCAGGCACCACCCCTCTGG + Intergenic
1147456627 17:40542103-40542125 GGCCCCAGCCAACACCTTGATGG - Intergenic
1148652020 17:49257116-49257138 GGCCTCAGGAACAAGCTTGCTGG - Intergenic
1148744992 17:49913082-49913104 GGCCCCAGGCCCCAGCTGACGGG + Intergenic
1149629847 17:58113528-58113550 TGGCCCTGCCACCACCTTGCAGG - Intergenic
1149871165 17:60183150-60183172 GCCCCCAGGCCTCACCTTTCGGG + Exonic
1150285169 17:63950150-63950172 GGCCCCAGACTCCACCCGGCAGG + Intronic
1150632856 17:66892220-66892242 TGCCCCAGGCACAGCCTTGTCGG - Intergenic
1151457564 17:74235446-74235468 AGCCCCAAGCACGCCCTTGCTGG - Intronic
1151473916 17:74334634-74334656 GGCCCCAGGGACACCCTTCCTGG + Intronic
1152478627 17:80535217-80535239 GGCCCCCGGCAGCCACTTGCAGG + Intergenic
1152553031 17:81039283-81039305 GGCCCCAGGCACTGTCCTGCCGG + Intronic
1152642346 17:81454484-81454506 GTCCCCAGGGACCCCGTTGCCGG - Intronic
1152811735 17:82385717-82385739 GGCCCCAGGCACAGCCTGGGTGG - Intergenic
1152962350 18:87373-87395 GGGCCCAGGCCCCATCCTGCAGG + Intergenic
1153984604 18:10341136-10341158 GGCAGCAGGGCCCACCTTGCAGG + Intergenic
1156577433 18:38334297-38334319 GGCACCAGGCACCACTTTGATGG - Intergenic
1157464140 18:47930360-47930382 GGGACCTGGCGCCACCTTGCAGG - Exonic
1158129402 18:54136212-54136234 GGACCCTGGCACCACACTGCTGG + Intergenic
1159050532 18:63417450-63417472 GCCCCCAACCACCACTTTGCTGG + Intronic
1160853586 19:1206149-1206171 GGCCCCGGCGACCACCTTGGGGG + Intronic
1160922190 19:1526243-1526265 CGCACCTGGCACCACCTTGAGGG - Intronic
1160924201 19:1535275-1535297 GGTCCCTGGCACTACCATGCAGG - Exonic
1160982790 19:1823882-1823904 GGCCGGAGGCACCACCTCCCTGG + Intronic
1161065068 19:2233451-2233473 GGCCCCAGGATCCACCTAACTGG - Exonic
1161067152 19:2244276-2244298 AGCCCCCGACACCACCTTCCTGG - Intronic
1161256901 19:3314756-3314778 GGGCCCGGGCACCTCCATGCTGG - Intergenic
1162371699 19:10283832-10283854 GGCCACAGGCACCGCATTGCAGG - Intronic
1162496230 19:11024787-11024809 GGCCCCAGGCCCCACCTGCCTGG + Intronic
1163812152 19:19440063-19440085 GGGCTCAGGCACCACCCTGTAGG - Intronic
1163831844 19:19550730-19550752 GGCCTCAGGCTCCATCGTGCTGG - Intergenic
1165749831 19:38253057-38253079 GGCCCCAGGGCCCAGCTGGCGGG + Intronic
1166747809 19:45150163-45150185 GGCTCCAGCCACCACCTCCCGGG + Exonic
1167433571 19:49466262-49466284 GGCCCAAGGCCACACCCTGCAGG + Exonic
1167909537 19:52690531-52690553 GGCCCCGCCCACCACCTCGCGGG - Intronic
1167999269 19:53431917-53431939 GGCCCCGCCCACCTCCTTGCGGG + Intergenic
925047336 2:782691-782713 GGCCCCAGAGACCACCTCCCTGG - Intergenic
925234736 2:2267751-2267773 GGATCCAGGCACCTCCTTGCAGG - Intronic
926324135 2:11769948-11769970 CTCCCCAGGCACCACCATTCTGG - Intronic
927431327 2:23028517-23028539 GGAGCCAGTCACCAGCTTGCAGG + Intergenic
927666958 2:25039442-25039464 TCCCCCAGGCACCACCCTCCAGG - Intergenic
928093945 2:28392770-28392792 AACCCCAGACTCCACCTTGCAGG - Intronic
928683933 2:33728572-33728594 GACACCAGGCACCACCTGCCTGG + Intergenic
934677646 2:96260960-96260982 TGCCCCAGTCACCACCTATCAGG + Intronic
934864213 2:97791494-97791516 GGGCCCAAGCTCCTCCTTGCTGG - Intronic
935154193 2:100468036-100468058 CTCACCAGGAACCACCTTGCTGG - Intergenic
935276112 2:101476545-101476567 GGCCCCAGCAACTACCTTCCAGG - Intergenic
935739081 2:106130787-106130809 GGACCCAGGCATCACCTCACTGG - Intronic
937274389 2:120674656-120674678 GACCCCAGGCCCCACGTGGCAGG + Intergenic
937869477 2:126777103-126777125 GGCCCCAGGGTCCACATTCCTGG - Intergenic
939950849 2:148470266-148470288 GTCCCCAACCACCATCTTGCAGG + Exonic
941896691 2:170636439-170636461 GGCTCCAGGCACCATCTGGAAGG - Intronic
942110261 2:172674861-172674883 CGTCCAAGGCGCCACCTTGCGGG + Intergenic
942315445 2:174693013-174693035 CCCCCCAGTCACCACGTTGCAGG + Intergenic
945980546 2:216307117-216307139 GGCCCCAGGAACCACCTGGAAGG + Intronic
946608268 2:221430247-221430269 GTTCCCAGGCTCCAGCTTGCTGG - Intronic
947714026 2:232330941-232330963 GACCCCAGGCAGCACCTAGGAGG + Intronic
947733234 2:232442321-232442343 GACCCCAGGCAGCACCTAGGAGG + Intergenic
1169092252 20:2868133-2868155 GGACCCAGCCACCATGTTGCAGG - Intronic
1169218571 20:3807423-3807445 GGCCCCGGGCGCCATCATGCTGG + Intergenic
1170863127 20:20127719-20127741 GGCCCCATCCACCACCTGGCAGG - Intronic
1172913626 20:38428217-38428239 CGCCCCAGGCAGCTCCCTGCAGG + Intergenic
1173015708 20:39223594-39223616 GGCCCCAGCTACCAGCTGGCAGG + Intergenic
1173720180 20:45251517-45251539 TGCCCCAAGTAGCACCTTGCAGG - Intergenic
1174390047 20:50213515-50213537 GGCCCCAAGCCCCACCTTCATGG + Intergenic
1175909267 20:62396908-62396930 GGCCCCAAGCAACACCCTGCTGG + Intronic
1176020191 20:62958769-62958791 AGTCCCAGGCAGCACCTTCCAGG - Intronic
1176046653 20:63096445-63096467 GGCCCCAGCCTCCACCTCGCTGG + Intergenic
1176047530 20:63100628-63100650 GGCCCCACACACCATCCTGCTGG + Intergenic
1176184956 20:63773371-63773393 GGCACAAGGCACCATCATGCTGG + Intronic
1178313905 21:31553657-31553679 AGCCCCAGGCCTCACCTTCCAGG - Intronic
1179026377 21:37682481-37682503 GGCCCCAGGCATTCCTTTGCTGG + Intronic
1179981947 21:44900280-44900302 GCACCCAGGCACCGCCTGGCAGG - Intronic
1183098819 22:35570870-35570892 GGGCCTTGGCACCACCTTGGAGG + Intergenic
1184262756 22:43328806-43328828 CACACCAGGCACCACCTTGATGG + Intronic
1184464859 22:44662879-44662901 GGCTCCAGTCACAGCCTTGCCGG + Intergenic
1184832207 22:46996049-46996071 GTCTGCAGGCACCACCTGGCAGG - Intronic
1185012059 22:48319788-48319810 GGGCCCAGGCACCCCTCTGCAGG - Intergenic
1185264681 22:49894783-49894805 GGCCCCAGTGACCATCCTGCCGG + Intergenic
950124896 3:10505078-10505100 GTCCCCTGCCACCAGCTTGCTGG + Intronic
952345794 3:32483901-32483923 GGGCTCAGGCACCACAATGCAGG + Exonic
953890054 3:46744657-46744679 GGCCGCAGTCACCACCCAGCTGG + Exonic
954138187 3:48591932-48591954 GGCCTCAGGCACCAAGTTCCAGG + Exonic
954618498 3:51982892-51982914 GGCCCCGGGCAGAACCTTGCAGG + Intronic
954638543 3:52084760-52084782 GGCCCCAGGTACCACCACCCAGG - Intronic
955940783 3:64145743-64145765 TGCCCCAGGCAGCACCACGCTGG + Intronic
960714295 3:120560090-120560112 GGACACAGGCATCACCTTGAGGG + Intergenic
961335927 3:126179846-126179868 GGCCCCAGGAGCCACGTTGTGGG + Intronic
961614592 3:128168758-128168780 CTCCCCAGGCATCTCCTTGCTGG + Intronic
961932300 3:130547202-130547224 GGCCTCAGCCACCTCCCTGCGGG - Intergenic
962289732 3:134123887-134123909 GGCCCAAGGTGCCACCTTGAGGG - Intronic
964465915 3:156992255-156992277 GCCCCCAGTCAGCACCCTGCAGG - Intronic
968515694 4:1014784-1014806 GGCCCGATTCCCCACCTTGCAGG - Intronic
969900633 4:10345870-10345892 GGACACAGGCACCACAGTGCAGG - Intergenic
971221951 4:24716879-24716901 GGCCCTAGGCCCACCCTTGCAGG - Intergenic
973548372 4:52005489-52005511 GGGCTCAAGCACCACCTTACTGG - Intronic
978468018 4:109030162-109030184 TGACCCAGGCACCACCTCTCTGG - Intronic
979325176 4:119370736-119370758 CTCCCCAAGCTCCACCTTGCAGG + Intergenic
980663674 4:135899927-135899949 GGCCACATGCACAACCTAGCAGG - Intergenic
980865933 4:138553362-138553384 GGCCCCAGCCGCCTCCCTGCGGG + Intergenic
981194325 4:141901121-141901143 GGCCAAAGGCCCCACCTGGCAGG + Intergenic
981434469 4:144703730-144703752 GGCTCCAGGCACCAACGTCCAGG + Intronic
983243081 4:165255760-165255782 CTCCCCAAGCTCCACCTTGCAGG + Intronic
984431871 4:179660862-179660884 GGCCACAGCGACCACCTTTCAGG + Intergenic
984500808 4:180556262-180556284 GCCCCCAAGCCCCATCTTGCTGG - Intergenic
986424833 5:7620965-7620987 GACACCAGGCAGCACCCTGCAGG - Intronic
987298402 5:16574687-16574709 GGCCCCAGGCTCCTCCTCCCAGG + Intronic
988413425 5:30915577-30915599 GGCCCCAGAGTCTACCTTGCAGG - Intergenic
989559585 5:42836023-42836045 GGCCCCAGGAACCATGTTCCAGG + Intronic
992112886 5:73512641-73512663 AGCCCCAGCCACCACCTGTCTGG - Intergenic
995187957 5:109290867-109290889 GGCCACAGGAACCACCTCACTGG - Intergenic
997677253 5:135721964-135721986 GGCCCCAGGCCCCACATACCTGG - Intergenic
998216201 5:140240141-140240163 GGTAACAGGCACCACCTTTCTGG - Intronic
1000350535 5:160349308-160349330 GGCCTCAGGCTCCACCATCCTGG - Exonic
1002316962 5:178349756-178349778 GGCCCCAGGCTCCTCCTTGCAGG + Intronic
1002333902 5:178465083-178465105 GACCCCTGGCCCCACCTGGCTGG - Intronic
1002516138 5:179760433-179760455 GGCCCCAGGCAGCACTGAGCAGG + Intronic
1002564244 5:180100948-180100970 AGCCCCAGGTACCCCCTTCCTGG - Exonic
1002649576 5:180681676-180681698 GGCCCCAGGCGTGACATTGCTGG + Intergenic
1005433766 6:25786516-25786538 GGCCCAAGGGACCACCTAGAAGG + Intronic
1005719303 6:28585493-28585515 GGCCCCAAACATCAACTTGCTGG + Intronic
1007224317 6:40302214-40302236 GGCCCCAGGCACAGACATGCAGG + Intergenic
1008572523 6:52829335-52829357 GGCCTCAGCCACCTCCCTGCAGG - Intergenic
1009371339 6:62906602-62906624 GGCACCAGGGACCACCTTTGGGG + Intergenic
1017086489 6:150717539-150717561 GGCCACCTGCACCTCCTTGCTGG + Intronic
1017559893 6:155615666-155615688 GGCCCCAGGCCCCACATGGCTGG - Intergenic
1017985524 6:159440018-159440040 GACCCCAGGCAGTACCCTGCAGG - Intergenic
1018149728 6:160926545-160926567 GGTCCCTGGCCCCACCTGGCTGG + Intergenic
1018309220 6:162491303-162491325 GGCACCAGGGACCACTTTGTAGG + Intronic
1018640442 6:165899663-165899685 GGCCCCAGGTACCACCCTTTAGG - Intronic
1018945961 6:168346676-168346698 GGCCCCAGGCAAGTCCTGGCTGG - Intergenic
1019309401 7:352948-352970 GCCCCAAGGCACCAGCTTGTGGG + Intergenic
1019440656 7:1044648-1044670 GGCCCCACTCACCGGCTTGCTGG - Intronic
1019538730 7:1541912-1541934 GGCCCCAGGCACCACCTTGCAGG - Exonic
1019587115 7:1811342-1811364 GGCTCCTGGCGCCTCCTTGCCGG + Intergenic
1023545708 7:41315991-41316013 TGCCCCATGCAGCACCTTCCAGG - Intergenic
1023867346 7:44244474-44244496 GGCCCCAGGGAGCCCCCTGCTGG - Intronic
1026849563 7:73716483-73716505 GGCCCCAGACACCAGCTGTCAGG + Intronic
1027934364 7:84584691-84584713 GGGCACAGGCACCAGCTAGCTGG - Intergenic
1029065328 7:97843007-97843029 GGCCTCAGCCACCTCCCTGCGGG - Intergenic
1029598988 7:101553020-101553042 GGGCCCAGGCATGAACTTGCCGG + Intronic
1030670065 7:112325867-112325889 GGCCGCAGCCAGCAGCTTGCTGG - Intronic
1032080932 7:128858131-128858153 GCCCCGAGTCACCACCTTGCTGG - Exonic
1032091316 7:128913029-128913051 GCCCCGAGTCACCACCTTGCTGG + Intergenic
1035282630 7:157787319-157787341 GCCTCCAGGCCCCACCTTGATGG + Intronic
1035371653 7:158382976-158382998 GGCACCAGGGACCAGCTTCCTGG - Intronic
1036643329 8:10597516-10597538 GGCCACAGGCAGGACCTCGCGGG + Intergenic
1040073463 8:43206622-43206644 GGCCCGAGGCCCCACGTTGGCGG + Intergenic
1040284187 8:46091675-46091697 GGCTCCAGCCACCACCTGGGGGG - Intergenic
1041298434 8:56386495-56386517 AGCCCCAGACATGACCTTGCAGG - Intergenic
1042267572 8:66925053-66925075 GGCCGCACGCACAACTTTGCTGG + Intergenic
1043111155 8:76184129-76184151 TGCCCCAGGCATCCCATTGCTGG - Intergenic
1046932653 8:119856284-119856306 TGACCAAGGCACCACCTTACAGG - Intergenic
1047254598 8:123206222-123206244 GGCCCCAGGCCTCTCCTTGAGGG + Intronic
1049742673 8:144248633-144248655 CTGCCCAGGCACCACCTTCCAGG + Intronic
1049744466 8:144257399-144257421 GGCCCCCAGCACCTCCTTCCTGG + Intronic
1051116268 9:13697859-13697881 AGCCACAGGGGCCACCTTGCTGG + Intergenic
1051352972 9:16215609-16215631 GGCCCCAGGAGACAACTTGCTGG + Intronic
1053114518 9:35489807-35489829 GTCGCCAGGCACCACCCCGCGGG + Intergenic
1053474443 9:38371969-38371991 GGCTCCACGCACCACCTTTGAGG - Intergenic
1054774257 9:69111620-69111642 GACTACAGGCACCACCGTGCTGG - Intergenic
1056369759 9:85941669-85941691 GGACCCAGGCAGAACCTCGCCGG - Intronic
1056453345 9:86737825-86737847 GGCACCACCCACCTCCTTGCTGG + Intergenic
1056545011 9:87606207-87606229 GCTCCCAGGCGCCACCCTGCAGG + Intronic
1056714132 9:89014281-89014303 GACCCCAGGGACCACAGTGCAGG - Intronic
1056793140 9:89639185-89639207 GGCCCCAGGAGCCACACTGCGGG - Intergenic
1057196217 9:93116731-93116753 GGACCCTAGCACTACCTTGCAGG + Intergenic
1057607537 9:96511135-96511157 GGCCTCAGCTACCACCATGCTGG + Intronic
1059706287 9:116826419-116826441 GGCTGCAGCCACCACCCTGCTGG + Intronic
1060151127 9:121289087-121289109 GGCCCCAGGCACCAACATAATGG - Intronic
1061389001 9:130306946-130306968 GGCCACAAGCATCACCTTACAGG + Intronic
1061680216 9:132239330-132239352 GGCCCCAGAGGCCACCTCGCAGG - Intronic
1062040816 9:134403518-134403540 GGCCCCAGGATGCCCCTTGCTGG + Intronic
1062221184 9:135416272-135416294 AGCCCGAGGTACCACCCTGCCGG - Intergenic
1062735791 9:138136744-138136766 GGGCCCAGGCCCCATCCTGCAGG - Intergenic
1187271886 X:17787620-17787642 GGCACCAGGGCCCACCTTCCTGG + Intergenic
1190333520 X:49249680-49249702 GGACACAGGCACCATCATGCGGG + Exonic
1190741263 X:53290368-53290390 GGTCCCAGGAACTTCCTTGCTGG + Intronic
1192807357 X:74522504-74522526 GGAGCCAGGCACCAGCTTGCTGG - Intronic
1194059855 X:89182947-89182969 GGCCACAGGCCCCACATGGCTGG - Intergenic
1196093726 X:111775970-111775992 AGCCCCAGGTGCCACTTTGCTGG - Exonic
1196766608 X:119251577-119251599 GCCCACAGGCCCCACCCTGCTGG + Intergenic
1199094830 X:143726380-143726402 GGCCTCAGCCACCTCCCTGCGGG - Intergenic
1200053874 X:153448688-153448710 AGCCCCAGGCACCACCAGGATGG + Intronic
1200398008 X:156002535-156002557 GGGCCCAGGCCCCATCCTGCAGG - Intronic
1200399393 X:156010292-156010314 GCACCCAGGCAACTCCTTGCTGG - Exonic
1201220727 Y:11767479-11767501 GGCACCTCCCACCACCTTGCAGG + Intergenic