ID: 1019539737

View in Genome Browser
Species Human (GRCh38)
Location 7:1546287-1546309
Sequence CCAGCCTCACAGGTGCCCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 221}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019539730_1019539737 -2 Left 1019539730 7:1546266-1546288 CCCACAGCCCCACGGTGCTGGCC 0: 1
1: 0
2: 3
3: 21
4: 268
Right 1019539737 7:1546287-1546309 CCAGCCTCACAGGTGCCCGCTGG 0: 1
1: 0
2: 2
3: 30
4: 221
1019539732_1019539737 -9 Left 1019539732 7:1546273-1546295 CCCCACGGTGCTGGCCAGCCTCA 0: 1
1: 0
2: 2
3: 18
4: 185
Right 1019539737 7:1546287-1546309 CCAGCCTCACAGGTGCCCGCTGG 0: 1
1: 0
2: 2
3: 30
4: 221
1019539733_1019539737 -10 Left 1019539733 7:1546274-1546296 CCCACGGTGCTGGCCAGCCTCAC 0: 1
1: 0
2: 1
3: 13
4: 148
Right 1019539737 7:1546287-1546309 CCAGCCTCACAGGTGCCCGCTGG 0: 1
1: 0
2: 2
3: 30
4: 221
1019539727_1019539737 29 Left 1019539727 7:1546235-1546257 CCAAGGTGTTTAAATATAAATAA 0: 1
1: 0
2: 1
3: 50
4: 561
Right 1019539737 7:1546287-1546309 CCAGCCTCACAGGTGCCCGCTGG 0: 1
1: 0
2: 2
3: 30
4: 221
1019539731_1019539737 -3 Left 1019539731 7:1546267-1546289 CCACAGCCCCACGGTGCTGGCCA 0: 1
1: 0
2: 3
3: 29
4: 291
Right 1019539737 7:1546287-1546309 CCAGCCTCACAGGTGCCCGCTGG 0: 1
1: 0
2: 2
3: 30
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019539737 Original CRISPR CCAGCCTCACAGGTGCCCGC TGG Exonic