ID: 1019540328

View in Genome Browser
Species Human (GRCh38)
Location 7:1548330-1548352
Sequence GAGAGGTCCCGCCAGCACGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 129
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019540328_1019540337 8 Left 1019540328 7:1548330-1548352 CCCCCGTGCTGGCGGGACCTCTC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1019540337 7:1548361-1548383 CATGCCCGCAGGTTCTACCCTGG 0: 1
1: 0
2: 0
3: 2
4: 50
1019540328_1019540333 -3 Left 1019540328 7:1548330-1548352 CCCCCGTGCTGGCGGGACCTCTC 0: 1
1: 0
2: 0
3: 9
4: 119
Right 1019540333 7:1548350-1548372 CTCCACTCCCTCATGCCCGCAGG 0: 1
1: 0
2: 1
3: 22
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019540328 Original CRISPR GAGAGGTCCCGCCAGCACGG GGG (reversed) Intronic
900604244 1:3516762-3516784 GACAGGTACGGCGAGCACGGTGG - Intronic
902546047 1:17190891-17190913 GAGAGGTCCCCCCAGGACCATGG - Intergenic
907320536 1:53599428-53599450 CAGAGGTCCAGCCAGCAAGAAGG + Intronic
911165573 1:94721460-94721482 AAGTGGTCCCCACAGCACGGGGG + Intergenic
913237439 1:116797025-116797047 GAGAGCTCCTGCCAGCTCAGGGG - Intergenic
918869342 1:189948608-189948630 GAGAGGTCCCATCAGCAGGAAGG - Intergenic
919901559 1:202047566-202047588 GACTGGGACCGCCAGCACGGGGG - Intergenic
920956483 1:210624243-210624265 GAGAGTTCCCACCAGCAAGAAGG + Intronic
921701627 1:218274980-218275002 GAGAGTTCCCACCAGCATGAAGG + Intergenic
922737527 1:227995652-227995674 GAGAGTTCCCACCAGCAAGAAGG - Intergenic
1066148467 10:32588117-32588139 GAGAGTTCCTACCAGCAAGGAGG + Intronic
1066180686 10:32958218-32958240 GGGAGGCCCCGCCAGCCCGCGGG - Intronic
1068827159 10:61453075-61453097 GAGTGCTCCGGCCAGCATGGAGG - Exonic
1075856953 10:125637928-125637950 GAGGGGGCCCGGCAGCAGGGGGG - Intronic
1076358239 10:129868505-129868527 GAGAGGTCACGCCAGCGGCGCGG - Intronic
1079803135 11:24896289-24896311 GAGAGGCGCCGCCAGAACCGGGG + Intronic
1081636657 11:44726683-44726705 GAGAGGGCCCGCGAGCAGAGCGG + Intronic
1085399197 11:76225423-76225445 GCGAGGGCCTGCCAGCCCGGCGG - Intergenic
1091747273 12:3000380-3000402 CAGAGTTCCCTCCAGCACGAAGG - Intronic
1092195749 12:6548731-6548753 GAGGGGCCCCGCCAGCCCGATGG - Exonic
1092282390 12:7108213-7108235 GGGGGGTCCCGCCAGGACTGTGG - Intronic
1093163790 12:15781787-15781809 GAGAGTCCCCACCAGCAAGGAGG - Intronic
1094849618 12:34376523-34376545 CAGAGGTCCCCCCACCACGGGGG - Intergenic
1096695312 12:53344978-53345000 GAGAGGGAGCGCCAGCCCGGGGG + Intronic
1103340118 12:120216633-120216655 GGGAGGTCCCGCCACCCCTGTGG - Intronic
1103607306 12:122096868-122096890 GAGAGCTCACGCCAGCTGGGGGG - Intronic
1104433183 12:128733262-128733284 AAGAGGTTTCTCCAGCACGGTGG + Intergenic
1104639202 12:130456606-130456628 GAGAAGTTCCGGCAGCACGCTGG - Exonic
1105408617 13:20151468-20151490 GTGACTTCCCGCCAGCATGGGGG - Intronic
1107474306 13:40720552-40720574 GAGAGTCCCCACCAGCAAGGAGG - Intergenic
1110155717 13:72313967-72313989 CATGGGTCCCGCCAGCACGGTGG - Intergenic
1116257258 14:42571609-42571631 GAGAAGACCTGCCAGCACAGAGG + Intergenic
1118595792 14:67434856-67434878 GAGAGTTCCCACCAGCAAGAAGG - Intergenic
1119309839 14:73636602-73636624 CAGACATCCGGCCAGCACGGTGG + Intergenic
1121101573 14:91253581-91253603 GAGCGGCCCCGCGAGCGCGGGGG - Intronic
1122174669 14:99908147-99908169 GGCAGGGGCCGCCAGCACGGGGG + Intronic
1123018688 14:105387466-105387488 GGGAGGCCCCGCGGGCACGGAGG - Intronic
1125548645 15:40527774-40527796 GAGAGTTCCCACCAGCAAGAAGG + Intergenic
1127101630 15:55571641-55571663 GAGAGGCCCCACAATCACGGTGG - Intronic
1128381177 15:67114202-67114224 GAGAGGACCCTCCAGCGCTGAGG - Intronic
1131153186 15:90059635-90059657 GGGAGCTGCCGCCGGCACGGGGG - Intronic
1132709495 16:1260083-1260105 CAGAGGTCCCGAAAGCACAGGGG + Intergenic
1132866516 16:2095561-2095583 CAGAGGCGCCGCCAGGACGGAGG + Intronic
1132934642 16:2474407-2474429 GAGAGGGCCCGGCATCACGAAGG - Intergenic
1133119606 16:3597947-3597969 GAGAGGACCCACCAGCAAGAAGG - Exonic
1134005784 16:10818299-10818321 GAGGGGCCCCGCCAGCTCGGAGG - Intronic
1135340094 16:21637797-21637819 GAGGGGTCCCCACAGCACAGCGG + Intronic
1137238182 16:46632945-46632967 GAGAGGACCTGCCAGCAGCGAGG - Intergenic
1137248592 16:46726850-46726872 GAGAAGTCCCTTCCGCACGGAGG + Intronic
1137253133 16:46754572-46754594 GAGAGGGCCCACCAGCAAGAAGG + Intronic
1137477343 16:48820649-48820671 GAGAGATCCACCCAGCAAGGTGG - Intergenic
1137962494 16:52897035-52897057 GAGAAGTCCACCCAGCAAGGTGG - Intergenic
1141673278 16:85504055-85504077 GAGAGGTGCGGGCAGCACCGTGG - Intergenic
1144440378 17:15275997-15276019 GAGAACTCCAGCCAGCACTGGGG - Intergenic
1144853195 17:18254392-18254414 GAGGGGTGCTGCCTGCACGGAGG + Intronic
1150032384 17:61753177-61753199 GAGAGTTCCCACCAGCAAGAAGG + Intronic
1151927685 17:77210957-77210979 AAGAGGTTCCGTCAGCACAGGGG + Intronic
1152281703 17:79388765-79388787 GAGAGGCTCCGGCAGCACCGGGG - Intronic
1152353676 17:79796885-79796907 GGGAGGGCCCGGCCGCACGGAGG + Intronic
1152532552 17:80927859-80927881 GAGAATTCCCGCCCGCACGGAGG + Intronic
1152664398 17:81558965-81558987 GAGAGGTCTTTCCAACACGGCGG + Exonic
1153975779 18:10267530-10267552 GTCAGGTCCCGTCAGCAGGGTGG - Intergenic
1154156790 18:11950238-11950260 AAAAGGCCCCGCCAGCAGGGTGG + Intergenic
1157327394 18:46678953-46678975 GAGAAGTCCCGCCTTCACAGCGG + Intronic
1160192373 18:76724503-76724525 GTGAGGGCTCTCCAGCACGGAGG + Intergenic
1161226378 19:3148458-3148480 GTGAGGTCCCGGCTGCACCGGGG + Intronic
1162568498 19:11457388-11457410 GAGGGGACCCGCCAGCCAGGAGG - Intronic
1163539355 19:17898033-17898055 GAGCCGTCACGCCAGCACGTAGG - Intergenic
1163668504 19:18614017-18614039 GTGAGGGCCCGCCGGCAGGGTGG + Intronic
1166732898 19:45068583-45068605 GAGAGGCCACGCAGGCACGGAGG + Intronic
1167628194 19:50606205-50606227 GTGAGCTCCCGCCAGCCCGCGGG - Intergenic
928950448 2:36808831-36808853 GAGTGGTGGCACCAGCACGGGGG + Exonic
930662134 2:54064796-54064818 TAGGGGGACCGCCAGCACGGTGG + Intronic
931348646 2:61470214-61470236 GAGAGGCCTCGGCAGCACGCTGG + Intronic
935734690 2:106097290-106097312 GAGAGGTCCCTCCAGCTGGGTGG - Intronic
938949573 2:136244227-136244249 GAGAGGCCCATCCATCACGGGGG + Intergenic
946102279 2:217336195-217336217 GAGAGGTCCCGCATCCACTGAGG - Intronic
948927829 2:241110739-241110761 GGCAGTTCCCTCCAGCACGGAGG + Intronic
1173603276 20:44311038-44311060 GAGGGAGCCCGCCAGCATGGAGG + Exonic
1173886686 20:46465408-46465430 GTAAGCTCCAGCCAGCACGGTGG + Intergenic
1175163478 20:57026117-57026139 GAGAGCTCCTGACAGCAGGGAGG + Intergenic
1175846973 20:62064700-62064722 CAGCGGCCCGGCCAGCACGGCGG - Exonic
1176135799 20:63521481-63521503 GAGAGGTCCCGTCAGCAACGCGG - Intronic
1179937137 21:44612998-44613020 GAGAGGTCACCTCAGCACAGGGG - Intronic
1180756824 22:18168183-18168205 GAGAGTTCCCACCAGCAAGCAGG - Intronic
1181455999 22:23060640-23060662 GAGAGGTTCCACCAGCAAAGGGG - Intronic
1182114171 22:27745492-27745514 GAAAGGCCCCACCAGCAAGGTGG + Intergenic
1183428243 22:37751006-37751028 GAGAGGTCTCCCCAGCAGGAAGG + Intronic
1183547683 22:38463569-38463591 CTGAGGTCCCGCCCGCCCGGAGG - Intergenic
1183686240 22:39362823-39362845 GAGAGGGCCAGGCAGCACGGGGG - Intronic
1184655589 22:45940526-45940548 GGGAGGTCCAGCCAGGAGGGAGG - Intronic
961647965 3:128402616-128402638 AAGATGTCCCCACAGCACGGAGG - Intronic
964028890 3:152113318-152113340 GAGAGTTCCCACCAGCAAGAAGG - Intergenic
968885441 4:3328494-3328516 TAGAGTCCCCGCCAGCACGTAGG + Intronic
972321537 4:37977308-37977330 GAGAGGTCGCGCCCGCGGGGCGG - Intronic
977722133 4:100251523-100251545 GAGAGTTCCCACCAGCAAGAAGG + Intergenic
985779041 5:1860259-1860281 GCGAGGCCCCGCGAGCACAGTGG - Intergenic
991168716 5:63594674-63594696 GAGAGTTCCCACCAGCAAGAAGG + Intergenic
992158485 5:73977993-73978015 GAGAGCCCCCGCCAGCAAGAAGG + Intergenic
994211199 5:97089167-97089189 GAGAGGTCTCACAATCACGGTGG - Exonic
996227598 5:121019783-121019805 GTGAGGTCCCCCCAGCCAGGTGG - Intergenic
997393945 5:133541413-133541435 GAGTGTTCCAGCCAGCATGGTGG + Intronic
1001990741 5:176113681-176113703 GGGGGGTCCCTCCAGCAGGGTGG - Intronic
1002226132 5:177724459-177724481 GGGGGGTCCCTCCAGCAGGGTGG + Intronic
1002478671 5:179484951-179484973 GAGAGGGCCGGCCGGCATGGGGG - Intergenic
1002857529 6:1051452-1051474 GAGAGGCCCCACCAGCAAGAAGG - Intergenic
1006380913 6:33696651-33696673 GAGAGGCCAGGCCAGCAGGGAGG - Intronic
1007733791 6:43967899-43967921 GACAGGTCCCGTCAGCACCTAGG - Intergenic
1011190945 6:84727594-84727616 GAGAGCTCTCACCAGCAAGGAGG + Intronic
1018828617 6:167424900-167424922 CAGAGGCCCCGTCAGCACCGTGG - Intergenic
1019013367 6:168861047-168861069 GAGTGGACCCGACAGCACGGGGG + Intergenic
1019540328 7:1548330-1548352 GAGAGGTCCCGCCAGCACGGGGG - Intronic
1020022797 7:4879077-4879099 GAGTGGCCTCGCAAGCACGGCGG + Intronic
1029428856 7:100516165-100516187 GGGAGGTCTGGCCAGCACGGTGG - Intergenic
1033153420 7:138936360-138936382 GCCAGGTCCTGCCAGCACTGTGG + Intronic
1034395864 7:150824680-150824702 GACAGGGCCAGCCAGCAAGGTGG + Intronic
1035301371 7:157899711-157899733 GAGAGGCCCCAACAGCAGGGAGG - Intronic
1039449800 8:37663297-37663319 GAGAATTCCCGCCAGCAAGAAGG - Intergenic
1042624919 8:70747540-70747562 GAGAGTTCCCACCAGCAAGAAGG + Intronic
1043034469 8:75178837-75178859 GAGAGGCCCCCACAGCACAGCGG + Intergenic
1046055277 8:109071259-109071281 GAGGGGCCCCCACAGCACGGCGG + Intergenic
1046511689 8:115212029-115212051 GAGAGTTCCCACCAGCAAGAAGG + Intergenic
1055328383 9:75156108-75156130 GAGAGTTCCCACCAGCAAGAAGG + Intergenic
1057689591 9:97271539-97271561 GAGAGGCCCCTACAGCACAGCGG + Intergenic
1061090159 9:128421576-128421598 GAGAGCTGGCCCCAGCACGGGGG - Intronic
1186684519 X:11911580-11911602 GATAGGTCCTGGCAGCAGGGAGG + Intergenic
1188686311 X:33074723-33074745 GAGAGTTCCCACCAGCAAGAAGG + Intronic
1197507622 X:127327425-127327447 GAGAGGCCCCACAATCACGGTGG + Intergenic
1199443741 X:147897411-147897433 GAGAGGCCCCCACAGCACAGCGG + Intergenic