ID: 1019541928

View in Genome Browser
Species Human (GRCh38)
Location 7:1555479-1555501
Sequence ACTCATCTGCAGAGGGAGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 392
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 351}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019541921_1019541928 -4 Left 1019541921 7:1555460-1555482 CCAGGATCCCTGAGACATTACTC 0: 1
1: 0
2: 0
3: 11
4: 136
Right 1019541928 7:1555479-1555501 ACTCATCTGCAGAGGGAGGGAGG 0: 1
1: 0
2: 3
3: 37
4: 351
1019541918_1019541928 17 Left 1019541918 7:1555439-1555461 CCAGGGGGACGCCGGCTGTCTCC 0: 1
1: 0
2: 19
3: 34
4: 123
Right 1019541928 7:1555479-1555501 ACTCATCTGCAGAGGGAGGGAGG 0: 1
1: 0
2: 3
3: 37
4: 351
1019541920_1019541928 6 Left 1019541920 7:1555450-1555472 CCGGCTGTCTCCAGGATCCCTGA 0: 1
1: 0
2: 2
3: 34
4: 313
Right 1019541928 7:1555479-1555501 ACTCATCTGCAGAGGGAGGGAGG 0: 1
1: 0
2: 3
3: 37
4: 351

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019541928 Original CRISPR ACTCATCTGCAGAGGGAGGG AGG Exonic
900507760 1:3038254-3038276 ACTGATGTGCAGACGGAGGTAGG - Intergenic
900556727 1:3284360-3284382 ATTTATCTGGAGGGGGAGGGAGG + Intronic
900935639 1:5764746-5764768 ACAAATCTGCAGAGACAGGGAGG - Intergenic
901422162 1:9158487-9158509 ACTGCCCTGCAGAGGGAGAGAGG - Intergenic
902199809 1:14824928-14824950 ACTCTTCTGCAGAGGCACTGAGG + Intronic
902242930 1:15100787-15100809 TCCCATCTGCAGAGCGAGGACGG + Intronic
903015105 1:20356475-20356497 ACTCATCTGGTGGGGCAGGGAGG - Intergenic
903246463 1:22019423-22019445 ACCCATCCTCAGAGGGAGGCTGG + Intergenic
903358352 1:22761888-22761910 GCTCCCCAGCAGAGGGAGGGGGG + Intronic
904004592 1:27357109-27357131 CTTCACCTGCAGGGGGAGGGAGG + Exonic
904005164 1:27359813-27359835 CCTCATCTGCTGAGGGTGGCGGG - Intronic
905351648 1:37350846-37350868 AAGCATCTGCAGAGGGAGTTGGG - Intergenic
905827701 1:41038741-41038763 CCTCATCTGCAGAAGGAGGTGGG - Intronic
906735817 1:48126041-48126063 ACTGAAGTGGAGAGGGAGGGAGG + Intergenic
907275342 1:53313877-53313899 ACTCAGCTGCAGAGCGAAGATGG + Intronic
907738554 1:57140327-57140349 CCTCATCTGTAGAATGAGGGAGG - Intronic
908271987 1:62431135-62431157 TCTCATCTGCAGGGGAAGGGTGG - Intergenic
908679428 1:66643233-66643255 ACTCATCTACAGAGAGAGGAAGG - Intronic
908695185 1:66831956-66831978 ACTGATGTGCACTGGGAGGGTGG + Intronic
909607479 1:77521733-77521755 AGTCATCCACTGAGGGAGGGAGG - Intronic
911146178 1:94554621-94554643 CCCCATCTGGACAGGGAGGGAGG - Intergenic
912553868 1:110501988-110502010 ACTCCACTGCAGCGGGAGAGGGG - Intergenic
912853451 1:113146869-113146891 AGCCATGGGCAGAGGGAGGGAGG - Intergenic
913633016 1:120727808-120727830 AGTCATTTGCAGAGAAAGGGGGG - Intergenic
914285701 1:146225107-146225129 AGTCATTTGCAGAGAAAGGGGGG + Intronic
914546732 1:148675859-148675881 AGTCATTTGCAGAGAAAGGGGGG + Intronic
914619832 1:149394808-149394830 AGTCATTTGCAGAGAAAGGGTGG - Intergenic
915087582 1:153398595-153398617 TCTCATCTCCAGAGGAAGTGGGG - Intergenic
915971457 1:160358132-160358154 GATCAACTGCAGGGGGAGGGAGG - Exonic
918119204 1:181522869-181522891 ACTCATCTGAAGAGGGGATGTGG - Intronic
919525031 1:198636526-198636548 ACTGATTCCCAGAGGGAGGGTGG - Intergenic
919978163 1:202626241-202626263 ATGCCACTGCAGAGGGAGGGTGG - Intronic
921075701 1:211698731-211698753 TCTTTTTTGCAGAGGGAGGGAGG + Intergenic
921284832 1:213599972-213599994 CCCCATGTGTAGAGGGAGGGAGG + Intergenic
922183749 1:223256494-223256516 AGTCATCTGCAGGAGGAGAGCGG - Intronic
922421715 1:225464996-225465018 GTTCAGCTGCAGAGGGAGGCTGG + Intergenic
923719758 1:236456727-236456749 ACACAGGTGCAGAGGGAGTGAGG - Intronic
1063101337 10:2952739-2952761 ACACATCCCCACAGGGAGGGGGG + Intergenic
1063260621 10:4385384-4385406 ACTCATCTCTAGAGGAAGGCAGG - Intergenic
1063427617 10:5962205-5962227 AGTCACCTGCACAGGGAGGAAGG - Intronic
1064399799 10:15012037-15012059 CCTCATCTCCAGAGGAAGAGGGG + Intergenic
1064724814 10:18268066-18268088 ACTCAGATGCAGAGGGAGGTGGG - Intronic
1065607427 10:27432640-27432662 ACTCACATGGAGAGGGAGGGAGG - Intergenic
1067182018 10:43995366-43995388 ACCCATGTGCAGAGGAAGGCGGG + Intergenic
1068423081 10:56821654-56821676 TCCCCTGTGCAGAGGGAGGGGGG - Intergenic
1069887271 10:71631757-71631779 AGTGATCTGCAGAGCTAGGGAGG - Intronic
1074039285 10:109772213-109772235 CCTCATCTGAGGAGGCAGGGAGG - Intergenic
1074052083 10:109889056-109889078 CCTCATCTGCAAGGGCAGGGTGG + Intronic
1074721110 10:116265949-116265971 AGAGAACTGCAGAGGGAGGGTGG - Intronic
1075198652 10:120382936-120382958 AGTCCTCTGGAGAGGGAGTGAGG + Intergenic
1075596058 10:123730012-123730034 CCTCATCTGCAGAGGAAAGGTGG - Intronic
1075656226 10:124162970-124162992 ACTCTGCTGCGGAGGGAGGGAGG + Intergenic
1075925441 10:126248128-126248150 CCTCATCTGCAGATTGAGTGTGG + Intronic
1075956471 10:126527453-126527475 ACTCATTGGCAGGGGTAGGGAGG - Intronic
1075962427 10:126580884-126580906 ACTTATGGGTAGAGGGAGGGAGG - Intronic
1076598004 10:131637896-131637918 ACTGAGCTGCAGAGGAGGGGAGG - Intergenic
1076823925 10:132957869-132957891 TCTCATCTGAAGACCGAGGGAGG + Intergenic
1079141341 11:17812056-17812078 CCCCTTCTGCAGATGGAGGGGGG - Intronic
1079946964 11:26755858-26755880 ACTCATGAACAGAGGGAAGGGGG + Intergenic
1080897111 11:36456001-36456023 AGTCATCAGCAGGGGGAGAGAGG + Intronic
1081831788 11:46121019-46121041 ACTCTTCTTCATGGGGAGGGAGG + Intronic
1082794841 11:57371454-57371476 GCTCAACTGTAGATGGAGGGCGG + Intergenic
1083879484 11:65540949-65540971 ACTCGGCTGCAGGGGCAGGGCGG + Exonic
1084640603 11:70423702-70423724 GCCTAGCTGCAGAGGGAGGGTGG + Intronic
1084940005 11:72607397-72607419 GCACATCTGGAAAGGGAGGGTGG - Intronic
1085221234 11:74875342-74875364 ACTCCCCTGCAGAGGCAGAGTGG + Intronic
1085793015 11:79512351-79512373 TCACAGCTGTAGAGGGAGGGAGG + Intergenic
1086931609 11:92699710-92699732 TATCATCTGCAGAGGGAAGTAGG + Intronic
1089022079 11:115226649-115226671 ACTTGTCTGCAGAGAGAGGACGG + Intronic
1089066223 11:115664103-115664125 ACTCAGTGGCACAGGGAGGGAGG - Intergenic
1089150268 11:116358603-116358625 ACACGTGTGCACAGGGAGGGTGG - Intergenic
1089432915 11:118437329-118437351 ACACATCTGCCCAGAGAGGGAGG - Intronic
1089548962 11:119255246-119255268 ACTCCTGGCCAGAGGGAGGGAGG + Intronic
1089623167 11:119734432-119734454 AGTTATCTGCAGAGAGAGGTTGG + Intergenic
1090236903 11:125154912-125154934 ACTGTGCTGCACAGGGAGGGTGG - Intergenic
1090873901 11:130771830-130771852 ACACATCCCCAGAGGGAAGGAGG + Intergenic
1091404260 12:199128-199150 ACACATCAGCAGGGGGAGGGTGG + Intronic
1091901380 12:4146810-4146832 ACGCATATGCAGAGGGAGTTGGG - Intergenic
1092664783 12:10783980-10784002 ACTCATCTCCATGGGGAGAGAGG - Intergenic
1093905749 12:24690165-24690187 ACCAAACTGCAGAGGGAGGCTGG + Intergenic
1096506843 12:52099080-52099102 CCTCATATCCAGAGGGAGAGAGG - Intergenic
1096843492 12:54392639-54392661 ACTTGTCTCAAGAGGGAGGGTGG + Intergenic
1097038241 12:56138242-56138264 ACTCAGCAGCAGTGGGACGGGGG - Exonic
1100273121 12:93045150-93045172 GGTCATCTGCAGAGGTAGTGAGG - Intergenic
1100717850 12:97324653-97324675 CGTCCTCTGCACAGGGAGGGAGG + Intergenic
1101659980 12:106757243-106757265 GCTCAGCAGCAGAGGGATGGTGG + Intronic
1102101262 12:110280948-110280970 ACCCACCTGCAGACGCAGGGTGG - Intronic
1102626229 12:114237432-114237454 ACTCCTCTTCAGAGGGGGGTGGG - Intergenic
1104323296 12:127772468-127772490 AGTCATCGGCAGAGGAAGAGTGG - Intergenic
1104678050 12:130729231-130729253 TCTCACCTGCAGAGGGAGACCGG - Intergenic
1104769789 12:131354172-131354194 ACTCCTCAGCAGAGGCAGGATGG - Intergenic
1104857856 12:131910237-131910259 ACTCATCTGCAGGAGGAAGGAGG - Exonic
1104946403 12:132416756-132416778 CCTCATCCCTAGAGGGAGGGGGG + Intergenic
1106656464 13:31752243-31752265 AGTCATCTGAAGAAGGAGGGGGG + Intronic
1106881702 13:34138908-34138930 CCTCATCAGCAGAGGCAGAGAGG - Intergenic
1108005410 13:45941425-45941447 CCCCAGCTGCAGAGGGAGGCTGG - Intergenic
1112078267 13:95936632-95936654 AGTTCTCTGCAGAGGGAGCGGGG + Intronic
1112188340 13:97149865-97149887 ACTCCCCTGCAGAGAGAGGAGGG - Intergenic
1112483422 13:99798144-99798166 ACCTATCTGAAGAAGGAGGGAGG + Intronic
1113868322 13:113543315-113543337 AGTCACCCACAGAGGGAGGGCGG - Intronic
1117011814 14:51478556-51478578 ATTGATCTGAAGTGGGAGGGAGG + Intergenic
1117514044 14:56482645-56482667 TCTCATCTGCAGAGGAATTGGGG + Intergenic
1118743157 14:68755906-68755928 ACTCAGCTGGAGTGGGGGGGGGG - Intergenic
1118787142 14:69055260-69055282 ACTCATCTACTGTGGGAGGCGGG + Exonic
1118886477 14:69870986-69871008 ACTCATGTGGAGAGGAATGGAGG + Intronic
1120142124 14:80941372-80941394 ACACCCCTGCCGAGGGAGGGAGG + Intronic
1120583973 14:86287671-86287693 AGTCATTAGGAGAGGGAGGGTGG + Intergenic
1122689895 14:103527311-103527333 AATCATCAGCTGAGGTAGGGGGG + Intergenic
1123114645 14:105889192-105889214 CCTCATCTTTAGAGGGAGTGCGG + Intergenic
1123163303 14:106301311-106301333 CCTGTTCTGCAGAGGTAGGGAGG + Intergenic
1125458402 15:39884830-39884852 ACTCTTGTGCAGAGTGGGGGTGG - Intronic
1126503966 15:49381136-49381158 ACTCATCACCACAGGGATGGTGG + Intronic
1127965844 15:63922448-63922470 CCCCTTCTGCAGAGGGAGGATGG - Intronic
1129107974 15:73322254-73322276 ACTCAGCACTAGAGGGAGGGAGG - Exonic
1129109329 15:73328604-73328626 CCTCATCTGCAGGGCGGGGGTGG - Intronic
1129705704 15:77792941-77792963 ACAGATGTGCACAGGGAGGGTGG + Intronic
1130086736 15:80783999-80784021 ACTCACCTGCAGGGGTGGGGAGG - Intronic
1131441994 15:92466543-92466565 ACTCCCCTGCAAAGGGATGGTGG - Exonic
1131697367 15:94892500-94892522 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
1131946278 15:97625634-97625656 AGTCAGCTGCAGATGGAGGTAGG + Intergenic
1132011364 15:98279477-98279499 TCTGATCTGCAGAGAGAAGGTGG + Intergenic
1132350421 15:101136460-101136482 GCTCATCTTCACAGGGATGGAGG - Intergenic
1132558431 16:582815-582837 CCCCGTCTGCAGAGAGAGGGTGG - Intronic
1133317458 16:4893365-4893387 AGGCATCTGTGGAGGGAGGGAGG + Exonic
1134046471 16:11104608-11104630 ACTTCTCTCCAGAGGGAGGAAGG + Intronic
1135289777 16:21225318-21225340 TCTCACGTGCTGAGGGAGGGAGG + Intergenic
1135946633 16:26870671-26870693 ACTCATCACCAAAGGGATGGTGG - Intergenic
1136772006 16:32848219-32848241 CCTGTTCTGCAGAGGTAGGGAGG - Intergenic
1136898604 16:34013302-34013324 CCTGTTCTGCAGAGGTAGGGAGG + Intergenic
1138918535 16:61498247-61498269 ACTCATAAGAAAAGGGAGGGAGG + Intergenic
1139021540 16:62755997-62756019 CCCCATGTGCAGAGGGAGGGAGG + Intergenic
1139878232 16:70163592-70163614 ACAACCCTGCAGAGGGAGGGGGG - Intergenic
1140359331 16:74331220-74331242 ACAACCCTGCAGAGGGAGGGGGG + Intergenic
1140406199 16:74713343-74713365 CCTCATCTGCGGAGGCTGGGAGG + Exonic
1140809988 16:78567722-78567744 ACTCAGCCACAGAGGCAGGGTGG - Intronic
1140905737 16:79407474-79407496 ACACACATGCAGAGGGAGAGAGG - Intergenic
1141307635 16:82881336-82881358 GGTCATCTGCTGTGGGAGGGAGG + Intronic
1141888953 16:86913684-86913706 CTTCATATGAAGAGGGAGGGTGG - Intergenic
1203074427 16_KI270728v1_random:1110308-1110330 CCTGTTCTGCAGAGGTAGGGAGG - Intergenic
1143331988 17:6144254-6144276 ACTCTTCGGCAGGGGGAGTGAGG + Intergenic
1143503325 17:7351281-7351303 TCTCATCTCCTGGGGGAGGGAGG - Exonic
1146541718 17:33701836-33701858 ACTGATGTGCAGAGGCAGGCTGG - Intronic
1147306766 17:39569533-39569555 AATTATCTGCACATGGAGGGCGG + Intergenic
1147702076 17:42402595-42402617 ACCCCTCTGCCGAGGGAGGTTGG - Exonic
1149912304 17:60577760-60577782 ACTGAGCTGAGGAGGGAGGGTGG + Intronic
1150187072 17:63194013-63194035 CCTCATCTACAGATGGAGGGGGG - Exonic
1150218110 17:63481404-63481426 ACTCATCTGCTGTGGGAGTGAGG + Intergenic
1151215849 17:72575857-72575879 ACTCACTTGCAGAGGCAGGAGGG + Intergenic
1151656776 17:75499835-75499857 ACTCCCCCACAGAGGGAGGGAGG - Exonic
1151678848 17:75613688-75613710 ACTCCTCTGCAGGGGCATGGGGG - Intergenic
1151784426 17:76268472-76268494 AGTCATCCCCAGAGGGTGGGGGG + Intronic
1151890821 17:76949501-76949523 CCTCAAGTGTAGAGGGAGGGTGG - Exonic
1152690236 17:81714664-81714686 CCTCATCTGCAGAAGGAGAATGG + Intronic
1155236596 18:23826053-23826075 ACATATCTGCAGAGGGAAGAGGG - Intronic
1157232885 18:45935700-45935722 ACACATGTGCAGTGGGTGGGAGG + Intronic
1157296741 18:46450466-46450488 ACTCACCAGCAGAGGTGGGGAGG - Intronic
1157484813 18:48079504-48079526 ACTCAACTGCAGTGGGATCGTGG + Intronic
1157736007 18:50049868-50049890 ACTCAGCTGCAGACAGACGGTGG + Intronic
1158747520 18:60218454-60218476 CCCCATGTGTAGAGGGAGGGAGG + Intergenic
1161141336 19:2649896-2649918 ACCCATCCGCAGAGTCAGGGAGG - Intronic
1161251730 19:3284503-3284525 ACTCATGTGGAGAGGGAGACGGG + Intronic
1162182018 19:8876431-8876453 ACTGAGCTGCAGAGGGAGAAGGG + Exonic
1163227731 19:15976693-15976715 TCTCTTCTGCAGAGAGAGAGGGG + Intergenic
1163345198 19:16736818-16736840 ACTGATCAGCAGAGGGAAGTAGG + Intronic
1163786174 19:19275972-19275994 ACTGTGCTGCAGAGGGAGGTTGG - Intergenic
1165123986 19:33581149-33581171 TCTCATCTGCAAAGTGAGGTGGG + Intergenic
1165769414 19:38370142-38370164 ACTCCTCTGCAGGGGTTGGGAGG - Exonic
1166654912 19:44603936-44603958 TGTCTTCTGCAGAGAGAGGGGGG + Intergenic
1167105280 19:47426814-47426836 ACTGATCTGCAGTGGGAGGTGGG - Intergenic
1167106754 19:47434719-47434741 ACTCATCTCCTAAGGGAGTGAGG + Intronic
1167116630 19:47492576-47492598 CCTCATCCACAGTGGGAGGGAGG - Intronic
1167440924 19:49508382-49508404 ACTCCTTTGGAGAGGGAGGCAGG + Intronic
1167615649 19:50531431-50531453 ACCCAGCTGCAGAGGGAAGGGGG + Intronic
1168124996 19:54278117-54278139 ACTCACCCTCAGAGGGAAGGAGG - Intronic
1168176986 19:54633437-54633459 ACTCACCCTCAGAGGGAAGGAGG + Intronic
925104748 2:1281852-1281874 ACACATCTGTGGAGGGAGGCGGG + Intronic
925195002 2:1915595-1915617 CCTCATCTGCAAAGTGAGGCAGG - Intronic
925298896 2:2795968-2795990 ACAGATCAGCAGAGGGAGGGAGG - Intergenic
925635487 2:5937904-5937926 TCTCATCAGCACAGTGAGGGAGG + Intergenic
926561640 2:14424235-14424257 AGTCATCTGAAGAGGCAGTGAGG + Intergenic
926695354 2:15766837-15766859 CCTCAACTGCAGAGGAGGGGAGG + Intergenic
927482085 2:23462081-23462103 TCTCAGCTGCTGAGGGAGGCAGG + Intronic
927916471 2:26939829-26939851 ACTCATCTACAGAATGAGTGTGG - Intronic
929977705 2:46651479-46651501 ACGAAAATGCAGAGGGAGGGCGG + Intergenic
930020881 2:47001464-47001486 CCTCATCTGCAGAGGGTGGGGGG + Intronic
932266385 2:70370753-70370775 CCTCATCTGTAGAGTGAGGATGG + Intergenic
932925987 2:75975133-75975155 AATCATCAGCAGAGGGAAGAGGG + Intergenic
932988997 2:76763569-76763591 ACTCATCTGCATAGGCTAGGTGG - Intronic
933858533 2:86441757-86441779 ACGCAACCGCAGAGGGAGTGAGG - Intronic
935534984 2:104283569-104283591 GCTCAGGAGCAGAGGGAGGGGGG + Intergenic
937278820 2:120703591-120703613 ACTCAGCTGCAGAGTGAGGAAGG - Intergenic
937870378 2:126782011-126782033 ACCCAGGTGCAGAAGGAGGGAGG - Intergenic
938086581 2:128405932-128405954 ACTGGTGTTCAGAGGGAGGGAGG + Intergenic
938376268 2:130808710-130808732 AGTGATCTGCAGAGGCAGAGTGG - Intergenic
939755229 2:146101775-146101797 AGTTATCTGCAGAGGAAGGCAGG - Intergenic
940598772 2:155829631-155829653 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
940693980 2:156956073-156956095 AGTTCTCTGCAGAGGGATGGGGG + Intergenic
940752953 2:157647804-157647826 ATTCATCTGCAGTGTCAGGGAGG - Intergenic
945682179 2:212927263-212927285 ACTCTTCTGCAAATGGAGGGAGG - Intergenic
945976715 2:216276841-216276863 AATCATCTGTTGGGGGAGGGAGG + Intronic
947754438 2:232551158-232551180 TCTCATCTGCAGAGTGGGGACGG + Intronic
948280996 2:236747986-236748008 ATTCTCCTGTAGAGGGAGGGAGG + Intergenic
948338750 2:237232154-237232176 AAGCATCTGGAGAGGGAGAGGGG - Intergenic
948632812 2:239312872-239312894 CTTCATCTGCAGAGGGAGACCGG + Intronic
948798811 2:240420807-240420829 TCCCATCTGCAGAGGGCGTGGGG - Intergenic
1168816715 20:742849-742871 CCTCCTCTACAGAGGGAGGAAGG - Intergenic
1169020969 20:2330542-2330564 AGTCATCTGCAGAGGCAGAGAGG - Intronic
1169456100 20:5753877-5753899 TCTCCCATGCAGAGGGAGGGGGG - Intronic
1170485622 20:16813039-16813061 ACCCAGCTGCAGAAGGAGGTAGG - Intergenic
1170714218 20:18817990-18818012 ACTCACCTTCAGAGCCAGGGAGG - Intronic
1170926707 20:20731245-20731267 ACACATATGCAGAGGGACGTGGG + Intergenic
1172181721 20:33007837-33007859 ACCCTTCTGCAGAGGGTGGCTGG - Intronic
1172538193 20:35690431-35690453 ACTCTTCTGCACTGGGAGGTAGG + Exonic
1173640742 20:44600236-44600258 GCTCATCTGCAGAGGCAGGCAGG + Intronic
1175404736 20:58718741-58718763 ATTAATCTGCAGCGGGAGGTGGG - Intronic
1176192441 20:63818421-63818443 TCAGTTCTGCAGAGGGAGGGTGG + Intronic
1176742338 21:10616130-10616152 ACTCATCTGTTGATGGTGGGTGG + Intergenic
1178016477 21:28351936-28351958 ACACATGTGGAGAGGAAGGGTGG + Intergenic
1178417409 21:32415036-32415058 AGGAATTTGCAGAGGGAGGGCGG - Intronic
1179088406 21:38241312-38241334 ACTCCACTGCAGAGGGAGGGTGG - Intronic
1179169188 21:38959544-38959566 ACTCTTCTTCAGAGGGAGCAGGG + Intergenic
1179472335 21:41620066-41620088 ACTTGTCTCCAGAGGGAAGGAGG + Intergenic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1179613566 21:42567358-42567380 ACGCCTCTGCAGAGAGAGAGGGG + Intronic
1179967600 21:44816499-44816521 CCTCATCTGTAAAGGGAGGGTGG + Intronic
1180637507 22:17272666-17272688 GCTCATTCCCAGAGGGAGGGAGG - Intergenic
1181084267 22:20432073-20432095 GCGCAACTGCAGAGGCAGGGAGG - Intronic
1181345177 22:22214836-22214858 TCTCACCTGCAGAGTGAGTGAGG - Intergenic
1181637435 22:24180988-24181010 ACTCATCCTCAGGGGGAGGCAGG - Intergenic
1183403157 22:37616713-37616735 ACTGATCTGGAGAGGGAGCTGGG + Intronic
1183929227 22:41226624-41226646 GCTCAGATGCAGAGGGAGAGGGG - Intronic
1184343950 22:43901593-43901615 ACTCATGTTGAGAGGGAGGGTGG - Intergenic
1185335302 22:50268603-50268625 GGTCACCTGCAAAGGGAGGGTGG - Intronic
1185349230 22:50326023-50326045 GCCCACCTGCAGATGGAGGGAGG - Intronic
949618918 3:5788036-5788058 AAATAACTGCAGAGGGAGGGAGG - Intergenic
949884908 3:8685054-8685076 CCTCATATCCAGAGGGAGAGAGG - Intronic
950720712 3:14880725-14880747 ACGTATCTGCAGAGGGAAAGAGG - Exonic
953131582 3:40144417-40144439 ACTAAGTTGGAGAGGGAGGGAGG + Intronic
953208087 3:40849657-40849679 TTTCATCTCCAGAAGGAGGGAGG + Intergenic
953274633 3:41482763-41482785 ACTTGTCTGCAGAGAGAGGAAGG - Intronic
954512571 3:51139242-51139264 ACTCAACTGCAGTGGGGGGAGGG + Intronic
954837901 3:53486711-53486733 ACTCAGTTACAGAGGGACGGAGG - Intergenic
955777137 3:62446051-62446073 ACTTTTTTTCAGAGGGAGGGAGG - Intronic
955782244 3:62497423-62497445 AGTCATCTCCAGAGGCATGGAGG - Intronic
956636110 3:71367161-71367183 ACTTCTGTGCAGAAGGAGGGAGG + Intronic
957044055 3:75360615-75360637 CCTCATATTCAGAGGGAGAGAGG + Intergenic
958898820 3:99861534-99861556 AATCAACTGCAGAGAGTGGGAGG - Intronic
960152208 3:114261901-114261923 ACACATGCACAGAGGGAGGGAGG + Intergenic
960950868 3:122997663-122997685 TCTTTGCTGCAGAGGGAGGGAGG - Intronic
961103106 3:124218698-124218720 ACTTTTCTGGAGAGGGAGGGCGG + Intronic
961678704 3:128584301-128584323 CCCCATCAGCAGAGGGAAGGAGG - Intergenic
962440878 3:135415149-135415171 ACTGCTCTGCAGAGGGTTGGTGG + Intergenic
962643162 3:137409376-137409398 ACCCATGTGTTGAGGGAGGGAGG + Intergenic
964970463 3:162553687-162553709 CCTCATGTGTTGAGGGAGGGAGG - Intergenic
965893161 3:173540124-173540146 AGTCATCTGCAGAGGATGGCAGG + Intronic
966480564 3:180403936-180403958 AGTTATCTGCAGAGGGTGGTAGG - Intergenic
966731279 3:183153363-183153385 AGTCTTCTGGAGTGGGAGGGAGG + Intronic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
968518211 4:1023624-1023646 TGTCATCTGCAGAGAGACGGAGG - Exonic
968869714 4:3235548-3235570 ACACATCTGCACAGGGAGAAAGG - Exonic
969842595 4:9893388-9893410 TCTCATTTGCAGGGGGAGGGCGG + Intronic
971635365 4:29049819-29049841 GATCATCTGCAGAGGGAGCGGGG + Intergenic
972082874 4:35175354-35175376 ACTCATCTGCTCAGGGATGCAGG + Intergenic
972436359 4:39039292-39039314 CTTCATATGCAGGGGGAGGGTGG + Intergenic
975039935 4:69734259-69734281 AATCATCTGCAGTGGGGGGTGGG + Exonic
975147898 4:70990669-70990691 ACACCTCTGCAGGGGGAGTGGGG + Intronic
975743373 4:77452342-77452364 GCTCCTCTGCAGAGAGGGGGAGG + Intergenic
976087327 4:81419792-81419814 CCTCATCTGCAGAGGATTGGGGG - Intergenic
976726919 4:88223794-88223816 CCTCATCTGGAGAGGGATGAAGG + Intronic
978330173 4:107603925-107603947 ACTCATCAGCAGATGAAGGCTGG - Intronic
979812891 4:125062286-125062308 ACCCATCTGCCAAGGCAGGGAGG + Intergenic
981555391 4:145988001-145988023 ACTCTTCTGGGGAGGGAGGAAGG - Intergenic
983578917 4:169288268-169288290 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
983831947 4:172338875-172338897 ACTTCTCTGCCCAGGGAGGGAGG + Intronic
984189154 4:176583891-176583913 AAACATCTCCTGAGGGAGGGAGG + Intergenic
984645008 4:182209882-182209904 AGTCATCTGCAGGGGGAGGTGGG + Intronic
984657195 4:182330928-182330950 TCTCATCTGAAGAGGGAGAGTGG + Intronic
985791652 5:1931373-1931395 CCTCACCTGCAGAGGGAAGGCGG - Intergenic
985814246 5:2114844-2114866 AATGATCTGCAGAGGGAGGCAGG - Intergenic
985887156 5:2688598-2688620 ACTCCTGAGCTGAGGGAGGGGGG - Intergenic
987945665 5:24605345-24605367 AATCAGCAGTAGAGGGAGGGGGG + Intronic
988018847 5:25597333-25597355 CCCCATGTGTAGAGGGAGGGAGG - Intergenic
988196715 5:28014020-28014042 ATTCATCTGCAGAGCTAGTGGGG - Intergenic
988678285 5:33457091-33457113 ACCCACCTGCAGATTGAGGGAGG + Intronic
991127206 5:63082889-63082911 GCTCCTCTGCAGAGAGGGGGAGG - Intergenic
992766061 5:80001565-80001587 ACCCATCTGCAGAGGGCTTGGGG + Intronic
995476714 5:112555441-112555463 CCTCATCTGCAAAGGAAGGAGGG + Intergenic
996873101 5:128213642-128213664 ACTCATCTGAGGAGGCAGGCAGG + Intergenic
997739937 5:136244357-136244379 ACTGATCTTCTGAGGGAGTGAGG + Intronic
997824002 5:137090402-137090424 TGTGATCTGCAGAGGGAGGAAGG - Intronic
998114403 5:139525145-139525167 ACACATCTTCAGAGAGGGGGTGG + Intergenic
999143628 5:149378837-149378859 TCCCATCTGGAGAGTGAGGGAGG - Intronic
999523376 5:152376190-152376212 ACTCATATGCAGTGGGATGGGGG + Intergenic
1000549229 5:162638509-162638531 ACTTATCTGAAGATTGAGGGAGG - Intergenic
1001583542 5:172817122-172817144 GCTCATCTGCAAAGTGGGGGCGG + Intergenic
1002348755 5:178567192-178567214 ACTTCTCTGCAGACAGAGGGAGG - Intronic
1002418150 5:179131610-179131632 AGGCACCTTCAGAGGGAGGGTGG + Intronic
1002793013 6:449288-449310 ACTGATCCCCAGAGGCAGGGAGG + Intergenic
1004237319 6:13885674-13885696 ACTCTTCTGCATAAGGATGGGGG - Intergenic
1004415619 6:15421668-15421690 ACTCAGCTGCCAAGTGAGGGTGG - Intronic
1004808680 6:19234161-19234183 CTTAATCTGCAGAGGGAAGGGGG + Intergenic
1004900287 6:20187303-20187325 TCTCATCTGTAAAGTGAGGGAGG + Intronic
1005344641 6:24877303-24877325 TCTCTCCTGGAGAGGGAGGGAGG - Intronic
1005452940 6:25991921-25991943 CCACATCTGGAGAGGGAGGTGGG - Intergenic
1005969539 6:30750461-30750483 CCTGATATGGAGAGGGAGGGAGG - Intergenic
1006641416 6:35491583-35491605 ACTCCTCTGCAGAGGCAGATGGG - Intronic
1006651468 6:35555158-35555180 ACTCAGCTGAGGATGGAGGGAGG + Intergenic
1007664507 6:43506389-43506411 CCTCCTTTCCAGAGGGAGGGAGG - Exonic
1007667707 6:43525310-43525332 ACCCATCTTTAGAGGGGGGGAGG - Intronic
1007940867 6:45780213-45780235 CCTCATCTGCAAAAGGAGAGGGG - Intergenic
1009362770 6:62835581-62835603 CCTAATTTCCAGAGGGAGGGAGG + Intergenic
1010985540 6:82419672-82419694 ACTCAGCAGTGGAGGGAGGGAGG - Intergenic
1011445678 6:87436561-87436583 AGTCATCTGAGGAGGGTGGGGGG + Intronic
1012108574 6:95197765-95197787 AGTTATCTGCAGAAGGTGGGAGG + Intergenic
1012217948 6:96611778-96611800 ACTGACTTGCAAAGGGAGGGAGG + Intronic
1014045609 6:116882184-116882206 ATACATCAGCAGAGGCAGGGAGG - Intronic
1015025135 6:128523259-128523281 ACTGTTCTGGAGAGGGATGGTGG + Intergenic
1017061570 6:150490127-150490149 AACCATCTTCAGAGGGAGGCTGG - Intergenic
1019025822 6:168962304-168962326 GCTCATCTGCACAGGGTTGGTGG - Intergenic
1019082685 6:169445929-169445951 GCTCTGTTGCAGAGGGAGGGGGG - Intergenic
1019167874 6:170110854-170110876 TCTCACCTGCAGAAGGAGGCGGG + Intergenic
1019541928 7:1555479-1555501 ACTCATCTGCAGAGGGAGGGAGG + Exonic
1019631913 7:2053982-2054004 ACCCTTCTGCAGAGGGAGGCAGG + Intronic
1019710509 7:2516262-2516284 ACTCATCGGCTGATGGAGAGCGG - Intronic
1019778115 7:2924360-2924382 TGTCATCTGCAGAGGGACGAGGG + Exonic
1020306681 7:6841111-6841133 CCTCATATCCAGAGGGAGAGAGG + Intergenic
1021546787 7:21822372-21822394 ACTCATTCCCACAGGGAGGGAGG + Intronic
1021903602 7:25311854-25311876 CCTCATATGTGGAGGGAGGGAGG + Intergenic
1022237002 7:28471691-28471713 GATCATCTGCAGAGTGAGGCAGG + Intronic
1022297696 7:29071711-29071733 AACCATCTGGGGAGGGAGGGCGG - Intronic
1022456695 7:30564245-30564267 CCTCTTCTGCAGAGAGAAGGTGG - Intergenic
1022596304 7:31716372-31716394 ACAAATATGCAGAGAGAGGGAGG + Intergenic
1022803854 7:33802184-33802206 ACTCAACATCAGTGGGAGGGAGG + Intergenic
1024272136 7:47650653-47650675 ACTCCTCTGCAGAGTGAGATTGG - Intergenic
1026932942 7:74234955-74234977 TCCCAACTGCAGTGGGAGGGAGG - Intronic
1028157364 7:87446719-87446741 ACTCAACGGCAGAGGGAGGATGG + Intronic
1028582682 7:92423539-92423561 AGTCATCTGGAGAGGAAGGCTGG - Intergenic
1029473275 7:100767814-100767836 ATTCAGCTGCAGAGGCAGGGAGG - Exonic
1029696563 7:102217543-102217565 AACCATCCCCAGAGGGAGGGAGG + Intronic
1032885009 7:136128209-136128231 GCTCATCTGCAGGGGGCGTGAGG + Intergenic
1034116078 7:148585090-148585112 AGTCATCTGCAGCGGGGAGGTGG - Intergenic
1034343551 7:150372352-150372374 TCGCAGCTGTAGAGGGAGGGGGG - Exonic
1034398411 7:150845632-150845654 ACACAGCTGCAGCTGGAGGGAGG + Intronic
1034401170 7:150862587-150862609 CCTCAGCTCCAGAGGGAGGGAGG - Intergenic
1036240146 8:7074373-7074395 CCTAATCTCCAGAGGGAGAGAGG - Intergenic
1036286085 8:7445184-7445206 GCTTCTCTGCAGAGTGAGGGAGG + Intronic
1036335389 8:7866345-7866367 GCTTCTCTGCAGAGTGAGGGAGG - Intronic
1036590913 8:10167198-10167220 ACTCAGCTGCAGTGGGAGCCCGG - Intronic
1036848381 8:12185164-12185186 ACACCTCAGCACAGGGAGGGAGG - Intronic
1036869741 8:12427445-12427467 ACACCTCAGCACAGGGAGGGAGG - Intronic
1037061047 8:14509946-14509968 CCTCACCTGTTGAGGGAGGGAGG - Intronic
1038424839 8:27458493-27458515 ACCCACCTGCAGAGTGACGGAGG + Exonic
1038795685 8:30707312-30707334 TCTCTTCTGCAGAGAGAGGGTGG - Intronic
1044098687 8:88102212-88102234 GCTTGTCTGAAGAGGGAGGGAGG - Intronic
1044544635 8:93445943-93445965 TCTCAGCTGCAAAGGAAGGGAGG - Intergenic
1045184628 8:99824763-99824785 ACACATGGGCACAGGGAGGGGGG - Intronic
1045242737 8:100416673-100416695 ACTCTGCTGCAGAGGGGGAGTGG - Intergenic
1045684931 8:104702221-104702243 CCTCACCTGTCGAGGGAGGGAGG + Intronic
1045777473 8:105822637-105822659 TCTCTCCTGCAGAGAGAGGGGGG + Intergenic
1045810266 8:106213157-106213179 ATACACCTGCAGTGGGAGGGTGG - Intergenic
1045860500 8:106811032-106811054 CCTCACCTGGAGAGGGAGGTTGG - Intergenic
1045864114 8:106845335-106845357 ACTCATTTTCAGAAGGAGGCAGG - Intergenic
1047106702 8:121739423-121739445 AGTCATGTGCAGATGGAAGGAGG + Intergenic
1047772243 8:128038900-128038922 AGACATCTGGAGAGGGAGAGAGG - Intergenic
1048051200 8:130818551-130818573 AAACATCTCCAGAGGGACGGAGG - Intronic
1048054990 8:130854847-130854869 AGTGACCTACAGAGGGAGGGAGG - Intronic
1048179546 8:132182487-132182509 CCTCATCTCCCCAGGGAGGGTGG + Intronic
1049143070 8:140975455-140975477 ACTCATGTGCAAAGGCATGGAGG - Intronic
1049277170 8:141725710-141725732 GAGCAGCTGCAGAGGGAGGGAGG - Intergenic
1049310324 8:141930761-141930783 CCTCATCTGTAGATGCAGGGTGG - Intergenic
1049421355 8:142517980-142518002 CCTCGTCTGCAGGGGGCGGGTGG + Intronic
1049775284 8:144401145-144401167 ACCCAGCTGCAGGGGGAGGGAGG + Intronic
1050196412 9:3088490-3088512 TCTCTCCTGCAGAGGGAGAGGGG - Intergenic
1055610449 9:78018956-78018978 ATTCTTCTGCAGCGGGTGGGAGG - Intronic
1056270933 9:84947493-84947515 GCACATGTGCAAAGGGAGGGAGG + Intronic
1056925432 9:90830415-90830437 ACTCATCTGCAAAGGGCTGGGGG - Intronic
1058656528 9:107226980-107227002 ACTTATGTGCAGAAGGAGGATGG + Intergenic
1059563468 9:115358426-115358448 CCTCATGTGTTGAGGGAGGGAGG + Intronic
1060000968 9:119958372-119958394 CCACATCTGCAGAGTGAGGATGG - Intergenic
1060417054 9:123438296-123438318 GATTAGCTGCAGAGGGAGGGGGG - Intronic
1060907773 9:127323406-127323428 ACTCAGCTGTAGAGGCAGGAGGG - Intronic
1061303423 9:129719214-129719236 ACTCACCTGCGGAGGTTGGGGGG - Exonic
1062215905 9:135389771-135389793 GCTCATATGAAGAAGGAGGGGGG + Intergenic
1062552456 9:137095874-137095896 AGTCATCTGCAAAGTGAGGCAGG - Intronic
1185745945 X:2573529-2573551 GAGCATTTGCAGAGGGAGGGAGG + Intergenic
1186428987 X:9488396-9488418 GCTCCTCTGCAGATGGAGGAAGG - Intronic
1186555859 X:10557582-10557604 CCTCATCTGCAGAATGAGGATGG + Intronic
1188016993 X:25116828-25116850 ACTCATCTGTAGATGGGTGGTGG + Intergenic
1190282447 X:48939988-48940010 ACACAGCTGCAGAGGGAGACAGG + Intronic
1192152109 X:68718862-68718884 CCTCATCTGTAAAGTGAGGGAGG + Intronic
1196711918 X:118771344-118771366 AATTATCTGCAGAGGCATGGAGG + Intronic
1198380410 X:136078170-136078192 ACTCATTTTCAGGGGGTGGGGGG + Intergenic