ID: 1019542133

View in Genome Browser
Species Human (GRCh38)
Location 7:1556225-1556247
Sequence CGGCAAGGCCAGGATCTGAA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 150}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019542129_1019542133 -10 Left 1019542129 7:1556212-1556234 CCCACTGTGGGTGCGGCAAGGCC 0: 1
1: 0
2: 1
3: 7
4: 117
Right 1019542133 7:1556225-1556247 CGGCAAGGCCAGGATCTGAAGGG 0: 1
1: 0
2: 0
3: 18
4: 150
1019542128_1019542133 -9 Left 1019542128 7:1556211-1556233 CCCCACTGTGGGTGCGGCAAGGC 0: 1
1: 0
2: 1
3: 12
4: 134
Right 1019542133 7:1556225-1556247 CGGCAAGGCCAGGATCTGAAGGG 0: 1
1: 0
2: 0
3: 18
4: 150
1019542124_1019542133 2 Left 1019542124 7:1556200-1556222 CCAACTGGAGGCCCCACTGTGGG 0: 1
1: 0
2: 1
3: 19
4: 344
Right 1019542133 7:1556225-1556247 CGGCAAGGCCAGGATCTGAAGGG 0: 1
1: 0
2: 0
3: 18
4: 150
1019542121_1019542133 4 Left 1019542121 7:1556198-1556220 CCCCAACTGGAGGCCCCACTGTG 0: 1
1: 0
2: 1
3: 12
4: 207
Right 1019542133 7:1556225-1556247 CGGCAAGGCCAGGATCTGAAGGG 0: 1
1: 0
2: 0
3: 18
4: 150
1019542120_1019542133 12 Left 1019542120 7:1556190-1556212 CCACGTGGCCCCAACTGGAGGCC 0: 1
1: 0
2: 1
3: 10
4: 164
Right 1019542133 7:1556225-1556247 CGGCAAGGCCAGGATCTGAAGGG 0: 1
1: 0
2: 0
3: 18
4: 150
1019542122_1019542133 3 Left 1019542122 7:1556199-1556221 CCCAACTGGAGGCCCCACTGTGG 0: 1
1: 0
2: 0
3: 14
4: 192
Right 1019542133 7:1556225-1556247 CGGCAAGGCCAGGATCTGAAGGG 0: 1
1: 0
2: 0
3: 18
4: 150

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019542133 Original CRISPR CGGCAAGGCCAGGATCTGAA GGG Exonic
900555446 1:3278149-3278171 CGGTAAGGCCAGGCTATGATAGG - Intronic
900700529 1:4045851-4045873 CTGCAAGGCCAAAATCTGCAGGG - Intergenic
901182768 1:7352822-7352844 TGGCAAGGCCCGGATCTTGAGGG + Intronic
901204713 1:7487581-7487603 CAGCAGGTCCAGCATCTGAATGG - Intronic
904689061 1:32280216-32280238 AGCCAAGGGCAGGAACTGAAAGG + Intronic
905938097 1:41840720-41840742 TGGCACGGCCAGGATCTGATGGG - Intronic
906678349 1:47709018-47709040 TGGCAGGGCCAGGCTCTGAAAGG - Intergenic
906727554 1:48054996-48055018 GGGCAAGGCCTGGATCTGCAGGG + Intergenic
907307162 1:53519849-53519871 AGTCAAGGCCAGGAGCAGAATGG + Intronic
907318328 1:53586905-53586927 AGGCCAGGCCAGGCACTGAAGGG + Intronic
908133670 1:61103946-61103968 AGTCAAGACCAGGATCTTAAAGG - Intronic
916025210 1:160827655-160827677 AGGCAAGGCCAGGCTATGACTGG - Intronic
920669656 1:207993601-207993623 CTGGAAGCCCAGGCTCTGAAGGG + Intergenic
922565685 1:226600335-226600357 GGGCATGGCCAGGATATGGAGGG + Intronic
923230857 1:231984858-231984880 TGGCAAGGACATGAACTGAACGG + Intronic
1067450021 10:46376380-46376402 AGGCAGGGCCAGGTCCTGAAAGG + Intronic
1067461651 10:46462606-46462628 CAGCAAGGCCAGGAGGTGAGAGG + Exonic
1067587224 10:47483383-47483405 AGGCAGGGCCAGGTCCTGAAAGG - Intronic
1067625543 10:47921995-47922017 CAGCAAGGCCAGGAGGTGAGAGG - Intergenic
1067634281 10:47991150-47991172 AGGCAGGGCCAGGTCCTGAAAGG - Intergenic
1074019873 10:109571313-109571335 GGGCAAAGCCAGGTTCAGAACGG + Intergenic
1076521917 10:131086596-131086618 TTGCCAGGCCAGGCTCTGAAAGG - Intergenic
1077515660 11:3000524-3000546 CAGCAAGTCCAGGATCTGCATGG - Intergenic
1080279081 11:30535780-30535802 CACCAAGGCCAGGCACTGAAAGG + Intronic
1080622424 11:33997845-33997867 CGTCAATGCCAGAAACTGAAAGG + Intergenic
1084026332 11:66452376-66452398 TGGCAGGGGCTGGATCTGAAGGG + Intronic
1084857642 11:71999158-71999180 GGGAAAGGCCAGGATGTGGACGG + Exonic
1084933421 11:72574506-72574528 AGGCAAGGCCAGATCCTGAAGGG - Intergenic
1085130135 11:74031308-74031330 AGGCAAGGCCTGGATCTTAAAGG - Intronic
1090837242 11:130462425-130462447 TGGCTAGCCCAGAATCTGAATGG - Intronic
1091222128 11:133935889-133935911 TGCCAAGGCCAGGGTCTGCATGG - Intronic
1102591118 12:113957637-113957659 CGGCAGGGCCAAGATCGGGAAGG + Intronic
1106485307 13:30167158-30167180 AGACAAGGCCAGAAGCTGAAAGG - Intergenic
1107670997 13:42746152-42746174 GGGAAAGGCCAGGTTGTGAAGGG + Intergenic
1113831450 13:113298445-113298467 CTTAAATGCCAGGATCTGAAAGG + Intronic
1119595395 14:75928167-75928189 CGGCTAGGCCAGGATCTCAGAGG - Intronic
1121423609 14:93832844-93832866 CGCCAAGGCCAGGAACTGCCAGG + Intergenic
1121694666 14:95903114-95903136 CGCCAAGGCCATGCTCTAAATGG - Intergenic
1124479307 15:30063993-30064015 TGGCAAGTCCAGAATCTGTAGGG - Intergenic
1125153405 15:36559898-36559920 TGGTAGAGCCAGGATCTGAATGG + Intergenic
1125255977 15:37763335-37763357 AGGCATGGTCAGTATCTGAAGGG + Intergenic
1128264089 15:66252959-66252981 CGGGAAGTCCAGGACCTGGACGG - Intronic
1128877518 15:71214652-71214674 CGGAAAGGCAAGGAACTGGATGG - Intronic
1130903857 15:88226426-88226448 GGGGAAGGCCAGGCACTGAAGGG + Intronic
1137415861 16:48278646-48278668 CTGCAAGGATAGGAACTGAATGG - Intronic
1140859646 16:79007731-79007753 CGGCAAAACCAGGATGTGAATGG + Intronic
1140868773 16:79087872-79087894 CGGAAAGGACAGGATGTGGAAGG + Intronic
1145262650 17:21364086-21364108 CAGCAAGGCCTGCATCTGCAGGG - Intergenic
1146056894 17:29585798-29585820 CGGAAAGGACAGGAACTGTAAGG + Intronic
1147983750 17:44292101-44292123 CAGCAAAACCATGATCTGAATGG - Intergenic
1150250957 17:63704266-63704288 GGGTAAGGCCAGGGTGTGAAGGG - Intronic
1152282991 17:79396373-79396395 GGGCAAGGCCAGGATGAGCAGGG - Intronic
1154139561 18:11811097-11811119 TGGCAAGGCCCGGATTTCAATGG - Intronic
1160100121 18:75912677-75912699 GGGCAAGTCCAGGATCAGCAGGG - Intergenic
1160298402 18:77657874-77657896 CAGCAGGGCCAGGGACTGAAGGG + Intergenic
1164829672 19:31310920-31310942 TGACAAGGCCAGGATCTCTAGGG + Intronic
1165030979 19:32998074-32998096 CTGCACGACCAGGCTCTGAAGGG + Intronic
1166007899 19:39919698-39919720 AGTCAAGGCCAGGATCAGAAAGG + Intronic
1166341134 19:42137900-42137922 TGGCAATTCCAGGATCAGAAAGG + Intronic
1167340625 19:48913725-48913747 CTACAAGGCTAGGATCTGCATGG + Intronic
1167919740 19:52773124-52773146 AGGCAAGGCCAGGAAAGGAAGGG + Intronic
1167927181 19:52830793-52830815 AGGCAAGGCCAGGAAAGGAAGGG + Intronic
1167931445 19:52869026-52869048 AGGCAAGGCCAGGAAAGGAAGGG + Intronic
926145144 2:10392764-10392786 TGGCAAGGCCAGGGGCTGCATGG - Intronic
928096750 2:28409562-28409584 CTGCAGGGCCAGGCTCTGAAGGG - Intronic
932693886 2:73937421-73937443 GAGCAAGGCCAGCATCAGAAAGG + Intronic
934790994 2:97059955-97059977 CAGGAAGGCCAGGAGCTGAGCGG - Intergenic
934815455 2:97322575-97322597 CAGGAAGGCCAGGAGCTGAGCGG + Intergenic
934822240 2:97385908-97385930 CAGGAAGGCCAGGAGCTGAGCGG - Intergenic
939774262 2:146365086-146365108 CAGAAAGGGCAGGATCTGCATGG - Intergenic
940286901 2:152041502-152041524 TGGCCAGGCCAGGGGCTGAAGGG + Intronic
946059763 2:216931834-216931856 CTGCAATGCCAGGAGCTAAATGG - Intergenic
947396351 2:229690479-229690501 GCCCAATGCCAGGATCTGAATGG + Intronic
947670679 2:231933713-231933735 GGGCCTGGCCAGGACCTGAAGGG + Intergenic
947964464 2:234267770-234267792 AGTCAAGGCCAGGTTCAGAAAGG + Intergenic
1168810851 20:703683-703705 CGGCTAGGCCAAGCTCTGATAGG - Intergenic
1168919792 20:1521714-1521736 CGGGAAGACCTGGGTCTGAAAGG + Intergenic
1169395479 20:5225211-5225233 CAGCAACACCAGGAGCTGAAAGG + Intergenic
1169807074 20:9570615-9570637 CAGCAAGGCCAGGGTGTGAAGGG + Intronic
1170110142 20:12796050-12796072 CTGCAGGGCCAGGTTCTGCAGGG - Intergenic
1171062662 20:21981428-21981450 GAGCAAGGCCTGGATTTGAAAGG + Intergenic
1172327649 20:34049131-34049153 TGCCAAAGCCAGGCTCTGAAGGG - Intronic
1173569259 20:44066169-44066191 TGGCAGGGCCAGGGTTTGAAAGG - Intronic
1173839353 20:46147159-46147181 CGGTAAAGCCAGGATTTGAATGG - Intergenic
1175304971 20:57969570-57969592 CAGCAAGGCCAGCATCCAAATGG - Intergenic
1176390172 21:6159128-6159150 CGGCAAGGCCTGGAGTTGAGTGG - Intergenic
1176751485 21:10694600-10694622 TGGAAAGGCCAGGAATTGAATGG - Intergenic
1179238385 21:39567151-39567173 CGGCAAGGCCAGGAGGTGGTGGG - Intronic
1179241302 21:39595338-39595360 TGGCAAGTCCAAGATCTGCAGGG - Intronic
1179733294 21:43379112-43379134 CGGCAAGGCCTGGAGTTGAGTGG + Intergenic
1181314387 22:21962215-21962237 AGGGAAGGCCAGGTCCTGAATGG + Intronic
1181394973 22:22614806-22614828 AGGCATGGGCAGGATCTGAGGGG - Intergenic
1181455543 22:23058322-23058344 CAGCAAAGCCAGAATCTCAAAGG - Intergenic
1182872116 22:33657100-33657122 AGGCAGGGCCAGGGTCTGGATGG + Intronic
1183269335 22:36850823-36850845 CCGAAGGGCCAGGAGCTGAAAGG + Intergenic
1183376762 22:37469816-37469838 TGGCAAGCCCAGGATCTGAGTGG - Exonic
1183405486 22:37628591-37628613 AAGCAAGACCAGCATCTGAAGGG + Intronic
1183550430 22:38479808-38479830 AGGCAAGCCCAGGGTCTGGAGGG - Intronic
1184444385 22:44538974-44538996 TGGAAAGGCCAGGATCTGCCTGG - Intergenic
953624119 3:44556695-44556717 GGGTAAGGCCAGGTTGTGAAGGG + Intronic
954632582 3:52055449-52055471 CTGGAAGGCCAGGATCAGGAAGG - Intronic
955114184 3:55981069-55981091 CACCAAGGCTAGGATCGGAAAGG + Intronic
955202242 3:56861671-56861693 CGGAAAGGCCTGGATCTGCTGGG + Intronic
955219171 3:57009550-57009572 TGGACAGGCCAGGATGTGAAGGG + Intronic
955560065 3:60179291-60179313 CGGCAGGGCAGGGATTTGAAAGG + Intronic
956487832 3:69740360-69740382 AGGTAAGGCCTGGATTTGAATGG - Intronic
957278432 3:78118706-78118728 CTGCAAGGTCAGAATCTAAAAGG - Intergenic
961302066 3:125928493-125928515 AGGCCAGGCCAGGATCAGATGGG + Intergenic
963535950 3:146528748-146528770 CAGCTGGGCCAGGACCTGAATGG + Exonic
968995577 4:3943352-3943374 AGGCCAGGCCAGGATCAGATGGG - Intergenic
969263816 4:6051177-6051199 CGGCAGGGCCAGGACCCCAAAGG + Intronic
969441850 4:7221896-7221918 CGTGAAGGTAAGGATCTGAATGG - Intronic
969532580 4:7738034-7738056 CTTCAAGGCCAGGCCCTGAAAGG - Intronic
970389765 4:15596177-15596199 TGGAAAGGCCAGGATATGGAAGG - Exonic
970662956 4:18306642-18306664 TGGCAAGGCCAAAATCTGCAGGG - Intergenic
981239154 4:142454283-142454305 TGGCAAGGGCAGAATGTGAAAGG - Intronic
981564085 4:146079936-146079958 CGGCAAGTCCAAAATCTGCAGGG + Intergenic
985063611 4:186101624-186101646 TTTCAAGGCCAGGATCTGGAAGG + Intergenic
985754274 5:1703871-1703893 CTGCAAGGCCTGGGTCTGGACGG + Intergenic
990835379 5:60013725-60013747 TGGCAAGGCCAGGATCAACATGG - Intronic
996372741 5:122770465-122770487 GGGCAAGCACAGGATCAGAATGG - Intergenic
997296119 5:132769704-132769726 GAGCAAAGCCAGGATCTGAATGG + Intronic
997762670 5:136464429-136464451 GGGCAAGCCCCAGATCTGAAAGG + Intergenic
998119114 5:139561608-139561630 CGGCAGGCCCAGGAGCTGAGTGG + Exonic
1005215990 6:23528849-23528871 AAGCAATGGCAGGATCTGAAAGG - Intergenic
1005498652 6:26411327-26411349 CTGCAAGGCCAGGCTTTGCAAGG - Intronic
1007900780 6:45410103-45410125 TGGGAAGGCCAGGACATGAAGGG + Intronic
1011780600 6:90785262-90785284 CAGCAAGTCCAAGATCTGTAGGG + Intergenic
1014757407 6:125316790-125316812 CAGCTATGCCAGGAGCTGAATGG - Intergenic
1014898201 6:126929641-126929663 GGTCAAGGCCAGGAGCTGAGAGG - Intergenic
1016154832 6:140792465-140792487 CGGCAAGGCCCAAATTTGAAGGG + Intergenic
1018876110 6:167824792-167824814 CGGGAAGCCCAGGAACTGAAAGG + Intergenic
1019542133 7:1556225-1556247 CGGCAAGGCCAGGATCTGAAGGG + Exonic
1020122598 7:5513509-5513531 GGGCAAGGCCAGGGTCAGGATGG + Intronic
1020126735 7:5536970-5536992 GGGCACAGCCAGGAGCTGAAGGG + Intronic
1023864893 7:44233938-44233960 GGGCTGGGCCAGGATCTGCAGGG - Intronic
1028957264 7:96707951-96707973 TGTCCAAGCCAGGATCTGAAAGG - Intronic
1029380533 7:100211504-100211526 TGCCCAGGCCAGGACCTGAAGGG - Exonic
1029670087 7:102024152-102024174 GGGCAAGGCCAGGCCCTGAATGG - Intronic
1033446818 7:141430553-141430575 CGGAAGAGCCAGGATTTGAATGG + Intronic
1036095246 8:5717009-5717031 CTGCAAGGGCAGGATCACAAGGG + Intergenic
1037245625 8:16831323-16831345 CGACAAAGGCAGGATCTGAGAGG - Intergenic
1041502528 8:58553785-58553807 CGGAAAGTCCTGGATTTGAAAGG + Intronic
1046970971 8:120223085-120223107 GGGAAAGGCAAGGACCTGAAAGG + Intronic
1048141228 8:131796604-131796626 AGGCAAGGCCTGGAGCTGAGAGG + Intergenic
1048889913 8:138937593-138937615 TGGCAAGTCCAGAATCTGTAGGG - Intergenic
1049522729 8:143102606-143102628 CAGCTAGTCCAGGATCTCAATGG + Intergenic
1051278177 9:15416964-15416986 GGGTAAGGGCAGGATCAGAATGG - Intergenic
1052536611 9:29755776-29755798 CGGCAAAGCCCTGATCTGAGAGG - Intergenic
1053205780 9:36185031-36185053 TGGCAAGTCCAGAATCTGCAGGG - Intergenic
1053289094 9:36868336-36868358 AGGCAGGGCCAGGATCTGAGAGG + Intronic
1055987923 9:82071382-82071404 TGGCAAGTCCAAAATCTGAAGGG - Intergenic
1056443562 9:86643482-86643504 TGGCGGGGCCAGGATCTGAAGGG + Intergenic
1058097342 9:100877933-100877955 AGGCATGGACAGAATCTGAAAGG + Intergenic
1059507214 9:114810411-114810433 CGATAAGGACAGGACCTGAATGG + Intergenic
1059920088 9:119150614-119150636 CTGCAAGGCCCAAATCTGAATGG + Intergenic
1060342941 9:122792873-122792895 AGGCAAGGCCAGGGTGGGAAAGG + Intergenic
1061327090 9:129870390-129870412 GGGCAAGAACAGGAGCTGAAGGG - Intronic
1062058793 9:134483436-134483458 CGGCAAGGCCTGGCTCGGAAAGG - Intergenic
1062288887 9:135785839-135785861 GGGCAAGGCCAGGATGTGCTGGG + Intronic
1062424159 9:136498320-136498342 CTGCAGGGCCAGGAGCTGCAGGG + Intronic
1186780019 X:12903129-12903151 CAGCAAAGCTTGGATCTGAACGG - Intergenic
1187538395 X:20165426-20165448 TGGAAAGGCCAGGATCTCATGGG - Intronic
1188423807 X:30023242-30023264 TGGCAAGTCCAGAATCTGCAGGG - Intergenic
1189412360 X:40783941-40783963 GGGCCAGGCCAGGATCTGTGTGG - Intergenic
1190214517 X:48470606-48470628 CGGAAAGGCCAGGAGCTGGCTGG + Intergenic
1190393651 X:49957539-49957561 AGGCGAGGCTAGGAACTGAAAGG - Intronic
1190731813 X:53231569-53231591 GTGGAAGGCCAGGCTCTGAAGGG + Intergenic
1194651860 X:96524660-96524682 TGGCAAGGCCAAAATCTGCAGGG + Intergenic