ID: 1019542634

View in Genome Browser
Species Human (GRCh38)
Location 7:1558459-1558481
Sequence ATGGCTGGGGGCCCGTTTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 96
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 83}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019542628_1019542634 3 Left 1019542628 7:1558433-1558455 CCGTCACGGACAACTATGAAGTG 0: 1
1: 0
2: 0
3: 4
4: 73
Right 1019542634 7:1558459-1558481 ATGGCTGGGGGCCCGTTTGAAGG 0: 1
1: 0
2: 2
3: 10
4: 83
1019542625_1019542634 25 Left 1019542625 7:1558411-1558433 CCCTCTGGCTGTGTCGGGATCAC 0: 1
1: 0
2: 1
3: 9
4: 86
Right 1019542634 7:1558459-1558481 ATGGCTGGGGGCCCGTTTGAAGG 0: 1
1: 0
2: 2
3: 10
4: 83
1019542626_1019542634 24 Left 1019542626 7:1558412-1558434 CCTCTGGCTGTGTCGGGATCACC 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1019542634 7:1558459-1558481 ATGGCTGGGGGCCCGTTTGAAGG 0: 1
1: 0
2: 2
3: 10
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019542634 Original CRISPR ATGGCTGGGGGCCCGTTTGA AGG Intronic
901974162 1:12930993-12931015 ATGGCTGGGGGCACCTTTGCCGG - Intronic
902011015 1:13270775-13270797 ATGGCTGGGGGCACCTTTGCCGG + Intergenic
903287692 1:22286856-22286878 AGGGCTTGGGGTCCATTTGAAGG + Intergenic
903669687 1:25028117-25028139 AGGTCTGGGGGCCCTTCTGAAGG + Intergenic
905846940 1:41241726-41241748 AAGGCCGGGGGCCCTTTGGAGGG - Intronic
913536056 1:119773710-119773732 ATGGCTGGGAGGGCATTTGACGG + Intergenic
922726143 1:227923918-227923940 ATGGCTAGTGCCCCGTTTGGTGG + Intronic
1063955028 10:11257644-11257666 ATGGCTGGGGCCTGGTTTGATGG + Intronic
1068589508 10:58839168-58839190 ATTGCTGAGGTCCCATTTGATGG - Intergenic
1076979095 11:195818-195840 ATGGGTGGGTGCCTGGTTGAGGG + Intronic
1077265716 11:1648503-1648525 CTGGCTGGGGGACAGTTTGGGGG + Intergenic
1079140162 11:17803317-17803339 ATGGATGGGTGCTCATTTGAAGG - Intronic
1082021644 11:47538927-47538949 ATGGCTGTGTGCCCAGTTGATGG - Intronic
1085703304 11:78764084-78764106 AAGGCTGTGGGCCTGTCTGATGG + Intronic
1086984839 11:93236476-93236498 ATGGCTGAAGGACCGTTTGGGGG - Intergenic
1096774876 12:53957645-53957667 ATGGCTGGTAGCCCCTTTAAGGG - Exonic
1097222640 12:57460058-57460080 AGGGCTGGGGGCCAGGTTGGGGG + Intergenic
1101984594 12:109435875-109435897 ATGGCTGGGGATCTGGTTGAAGG + Intronic
1103360925 12:120353191-120353213 ATGGCTGGGGGTCTGCTTGCTGG - Intronic
1104953540 12:132453200-132453222 GTGGCTGGGGGGCAGTGTGATGG - Intergenic
1106358389 13:29006616-29006638 ATGGATGGTGGCCATTTTGAAGG + Intronic
1112910930 13:104483373-104483395 ATGCCTGGGGGCCCGGTTGATGG - Intergenic
1113574123 13:111382350-111382372 ATGGTTGGGGGGCTGTTTCAGGG + Intergenic
1114552138 14:23538800-23538822 AGGGCTGGGGGCCTCTGTGAAGG + Intronic
1122375349 14:101253396-101253418 ATAGCTGGGGGTCCGTGGGATGG - Intergenic
1129460125 15:75696330-75696352 AGGTCTGGGGGCCCGTGGGAGGG + Intronic
1133477554 16:6138167-6138189 ATGACTTAGGGCCCATTTGATGG + Intronic
1134629234 16:15745085-15745107 AGGGCTGGGGGCCCCTGGGAAGG + Intronic
1135517800 16:23149657-23149679 AAGGCTGGGCTCCCGTTGGATGG + Intergenic
1135580226 16:23619281-23619303 ATGGCTGGGGACTCCTGTGATGG + Intronic
1138346446 16:56323151-56323173 ATGGCTGGAGCCCCGTGAGAGGG + Intronic
1141710486 16:85696039-85696061 ATGGGTGGGGGCCAGCCTGAAGG + Intronic
1142466585 17:140636-140658 ATGGGTGGGTGCCTGGTTGAGGG + Intergenic
1151584594 17:75001486-75001508 ATGGGTGAGGGCCCGGCTGAGGG + Exonic
1154219784 18:12441868-12441890 CTGCCTCGGAGCCCGTTTGATGG - Intergenic
1158437840 18:57446443-57446465 ATGGCTGGGGGGCTGTTTGGTGG + Intronic
1159958126 18:74534195-74534217 GTGGCTGTGGGCCCTTGTGATGG - Intergenic
1160510282 18:79449710-79449732 CAGGCTGGGAGCCCGTGTGATGG + Intronic
1161638676 19:5405845-5405867 GTGGCTGGGGGCCAGGCTGAAGG + Intergenic
1162925921 19:13930515-13930537 GGGGCTGGGGGCCCGGATGAGGG - Exonic
925055098 2:851188-851210 AGGGGTGGGGGCCAGTGTGAGGG + Intergenic
928320334 2:30278190-30278212 AGGGCTGGGGTCCCATCTGAAGG - Intronic
933916809 2:87003114-87003136 ATGGCTGGGGTCTCATCTGAAGG - Intronic
933924754 2:87081350-87081372 GTGGTTTGGGGCCCGTTTGCTGG + Intergenic
934006185 2:87766800-87766822 ATGGCTGGGGTCTCATCTGAAGG + Intronic
935769786 2:106407073-106407095 ATGGCTGGGGTCTCATCTGAAGG + Intronic
935910308 2:107888847-107888869 ATGGCTGGGGTCTCATCTGAAGG - Intronic
935968430 2:108505695-108505717 ATGGCTGGGGTCTCATCTGAAGG - Intronic
936132100 2:109853990-109854012 ATGGCTGGGGTCTCATCTGAAGG - Intronic
936212597 2:110517495-110517517 ATGGCTGGGGTCTCATCTGAAGG + Intronic
936421735 2:112372075-112372097 ATGGCTGGGGTCTCATCTGAAGG + Intronic
936526324 2:113244204-113244226 ATGGCTGGGGGCCAGGGGGAGGG + Intronic
940036206 2:149314701-149314723 AAGGCTGGAGGCCCCTTTCATGG - Intergenic
947115631 2:226767477-226767499 ATGGCTAAGGGCCCTTTTGTTGG - Intronic
948297828 2:236876056-236876078 GTGGCTGGGGGCCTCTTTGACGG - Intergenic
948688581 2:239687773-239687795 ATGGCTGGGGGAAAGTCTGACGG - Intergenic
948787348 2:240359432-240359454 ATGGGTGGGGGTTGGTTTGAGGG - Intergenic
1168880146 20:1199472-1199494 AAGCCTGGTGGCCTGTTTGAAGG + Intergenic
1175133833 20:56808515-56808537 ATGGCTGGGGGCCTGTCCCAGGG + Intergenic
1175386416 20:58598305-58598327 ATGGCTGGGAGCCAGTTTAGAGG - Intergenic
1180159562 21:45992964-45992986 ATGGCTGGGCGCCGGCTTCAGGG - Intronic
1181061832 22:20285457-20285479 ATGGCTGAGGGCCTGTTTGGGGG + Intergenic
1181602178 22:23959178-23959200 ATGGCTGGGGGCCTGTCAGACGG - Intronic
1181606332 22:23982129-23982151 ATGGCTGGGGGCCTGTCAGACGG + Intronic
1182093154 22:27609580-27609602 CGGGCTGGGGGCCGGGTTGAGGG - Intergenic
949793785 3:7823483-7823505 TTGGCTGGGGGCATGTCTGATGG - Intergenic
950941990 3:16902081-16902103 ATGGCTGGGGGCATGCTAGAGGG - Intronic
951674609 3:25223160-25223182 AGGGCTGGGGGCCAGTTGGTGGG - Intronic
953032695 3:39188585-39188607 CTGGCTGGGGTCCTGGTTGATGG + Exonic
954675485 3:52313191-52313213 ATGGCTGGGGGCCCTGTTGATGG + Intergenic
974985903 4:69025951-69025973 AAGGCTGGGGCCCCAGTTGAGGG + Intronic
975715023 4:77197298-77197320 ATGTCAGAGGGCCCGTTTGTAGG - Intronic
983715430 4:170776320-170776342 ATGCCTGGGGGCTGGGTTGATGG + Intergenic
987733314 5:21805886-21805908 ATGGCTTGGAGCCCATTTAATGG + Intronic
988165908 5:27589909-27589931 TTTGCTGGGGGCTCGTTTGTAGG + Intergenic
999696083 5:154190139-154190161 ACGGCTGTGGCCCCGTTTCATGG + Intronic
1001564382 5:172690018-172690040 GGGGCTGGGGCCCCGCTTGAGGG - Exonic
1011502370 6:88005100-88005122 CTGGCTGGAGGCCCTTGTGAGGG + Intergenic
1013599671 6:111692381-111692403 ACGGCTGGGGGCCAGGCTGAGGG + Intronic
1019542634 7:1558459-1558481 ATGGCTGGGGGCCCGTTTGAAGG + Intronic
1026760400 7:73122065-73122087 ATGGCTGGGGGCTGGTGGGAAGG - Intergenic
1027036742 7:74930886-74930908 ATGGCTGGGGGCTGGTGGGAAGG - Intergenic
1027086821 7:75270573-75270595 ATGGCTGGGGGCTGGTGGGAAGG + Intergenic
1029188495 7:98755769-98755791 AGGGCTGGGGGCCCGGATGCTGG - Intergenic
1029393123 7:100288571-100288593 ATGGCTGGGGGCTGGTGGGAAGG + Intergenic
1032454978 7:132066381-132066403 AAGGCTGGGTGCTCCTTTGATGG - Intergenic
1033254499 7:139788582-139788604 TTGGCTGGTGGGCAGTTTGATGG - Intronic
1037787498 8:21911629-21911651 AAGGCTGGGGGCCCAGGTGAGGG - Intronic
1037792691 8:21960271-21960293 ATGACTGTGGGCCCGTTTCAGGG + Intronic
1041753538 8:61288117-61288139 AAGGCTGGGCGGCCGTGTGAAGG + Exonic
1049060502 8:140272809-140272831 ATGGCTGGGTGCTCGTCTCATGG - Intronic
1053221804 9:36318752-36318774 ATGGCTGGGGGCCAGAGTGGCGG + Intergenic
1060749512 9:126159773-126159795 AGGGCTGGGGGCCCGGTTGGGGG - Intergenic
1189318033 X:40069552-40069574 ATGGCTGGGGGCCTGGAGGAAGG - Intronic
1190650289 X:52562908-52562930 AGTGCTGGGGGCCCTGTTGAAGG - Intergenic
1196288997 X:113916567-113916589 ATATTTGGGGGCCCGTGTGAAGG + Intergenic