ID: 1019544111

View in Genome Browser
Species Human (GRCh38)
Location 7:1564998-1565020
Sequence CACAGGAGCGAGGCCCCAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019544111_1019544119 18 Left 1019544111 7:1564998-1565020 CCCGCTGGGGCCTCGCTCCTGTG No data
Right 1019544119 7:1565039-1565061 TCCTCCCATTGACTCCTTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019544111 Original CRISPR CACAGGAGCGAGGCCCCAGC GGG (reversed) Intergenic
No off target data available for this crispr