ID: 1019545039

View in Genome Browser
Species Human (GRCh38)
Location 7:1570074-1570096
Sequence CCTGACTTCCGGAAGGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 156}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019545039_1019545046 -7 Left 1019545039 7:1570074-1570096 CCGTCCACCTTCCGGAAGTCAGG 0: 1
1: 0
2: 0
3: 3
4: 156
Right 1019545046 7:1570090-1570112 AGTCAGGGCCGCGGCGCTTCTGG 0: 1
1: 0
2: 0
3: 6
4: 106
1019545039_1019545047 -1 Left 1019545039 7:1570074-1570096 CCGTCCACCTTCCGGAAGTCAGG 0: 1
1: 0
2: 0
3: 3
4: 156
Right 1019545047 7:1570096-1570118 GGCCGCGGCGCTTCTGGTCCCGG 0: 1
1: 0
2: 0
3: 13
4: 173
1019545039_1019545054 17 Left 1019545039 7:1570074-1570096 CCGTCCACCTTCCGGAAGTCAGG 0: 1
1: 0
2: 0
3: 3
4: 156
Right 1019545054 7:1570114-1570136 CCCGGAGACTTGGGGCTCCCGGG 0: 1
1: 0
2: 0
3: 25
4: 191
1019545039_1019545049 7 Left 1019545039 7:1570074-1570096 CCGTCCACCTTCCGGAAGTCAGG 0: 1
1: 0
2: 0
3: 3
4: 156
Right 1019545049 7:1570104-1570126 CGCTTCTGGTCCCGGAGACTTGG 0: 1
1: 0
2: 0
3: 17
4: 290
1019545039_1019545056 28 Left 1019545039 7:1570074-1570096 CCGTCCACCTTCCGGAAGTCAGG 0: 1
1: 0
2: 0
3: 3
4: 156
Right 1019545056 7:1570125-1570147 GGGGCTCCCGGGCTTCTGAGCGG 0: 1
1: 0
2: 2
3: 21
4: 213
1019545039_1019545050 8 Left 1019545039 7:1570074-1570096 CCGTCCACCTTCCGGAAGTCAGG 0: 1
1: 0
2: 0
3: 3
4: 156
Right 1019545050 7:1570105-1570127 GCTTCTGGTCCCGGAGACTTGGG 0: 1
1: 0
2: 2
3: 24
4: 625
1019545039_1019545052 16 Left 1019545039 7:1570074-1570096 CCGTCCACCTTCCGGAAGTCAGG 0: 1
1: 0
2: 0
3: 3
4: 156
Right 1019545052 7:1570113-1570135 TCCCGGAGACTTGGGGCTCCCGG 0: 1
1: 0
2: 0
3: 8
4: 192
1019545039_1019545051 9 Left 1019545039 7:1570074-1570096 CCGTCCACCTTCCGGAAGTCAGG 0: 1
1: 0
2: 0
3: 3
4: 156
Right 1019545051 7:1570106-1570128 CTTCTGGTCCCGGAGACTTGGGG 0: 1
1: 0
2: 0
3: 11
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019545039 Original CRISPR CCTGACTTCCGGAAGGTGGA CGG (reversed) Intronic
900435526 1:2629008-2629030 CCGGACTCCCGGAGGGTGGGGGG - Intronic
901736353 1:11314720-11314742 CCTGCCTCCCTGAACGTGGATGG + Intergenic
905003222 1:34689727-34689749 CCTTAGTGCAGGAAGGTGGATGG - Intergenic
906481684 1:46203454-46203476 CCTGACCTGCGGGATGTGGAGGG + Exonic
907689211 1:56645517-56645539 CCTGACTTGCGGGAGGCCGAGGG + Intronic
911150496 1:94593407-94593429 CCTGGCTTCAGGAAAGGGGATGG + Intergenic
913490452 1:119374872-119374894 CCTGACTGAGGGAAGGAGGAAGG - Intronic
915948437 1:160171255-160171277 GCTGTCCTCCCGAAGGTGGATGG - Exonic
916008112 1:160680232-160680254 TCTGACTTCAGGATTGTGGAGGG + Intronic
920501913 1:206490867-206490889 CCTGTCCTCCGGCAGGTGGGTGG + Intronic
923818862 1:237412684-237412706 CCAGAATTCAGGAAGGTCGACGG - Intronic
924851295 1:247833796-247833818 CCTGCCTTGAGGATGGTGGATGG + Intergenic
1064310545 10:14208518-14208540 CCTGCCTTGGGGAAGGAGGAGGG + Intronic
1065963816 10:30754782-30754804 CCAAACTTCAGCAAGGTGGAAGG - Intergenic
1067285323 10:44903649-44903671 CCTGATTTCTGGTAGGGGGATGG - Intergenic
1069717415 10:70529961-70529983 CCCAACTTCCGGCAGGTGCAGGG + Exonic
1070545883 10:77452131-77452153 CCTGGCCTCTGGAAGGAGGAAGG + Intronic
1070644956 10:78195386-78195408 CCTGGCCTTCAGAAGGTGGAAGG + Intergenic
1070763164 10:79038087-79038109 ACTGACTACCGGAAGTTGAAGGG + Intergenic
1071307446 10:84311647-84311669 CAAAACTTCCGTAAGGTGGAAGG + Intergenic
1073541624 10:104319869-104319891 CCTGAATTCCAGAGGGAGGAGGG - Intronic
1074100029 10:110347652-110347674 CCGGACTTCCTGAAGGTGCCTGG + Intergenic
1075977105 10:126705486-126705508 CCTCACTTCTGTAAGGAGGAAGG + Intergenic
1076277514 10:129215496-129215518 CATGACTTCTGGAAGGAGAAAGG + Intergenic
1076832496 10:133003317-133003339 CCTGAATTCCAAAAGGGGGAGGG + Intergenic
1079288201 11:19159832-19159854 TGTGACTTCAGGTAGGTGGAAGG + Intronic
1080971252 11:37279852-37279874 CCTGCCAGCCAGAAGGTGGATGG - Intergenic
1083145729 11:60757071-60757093 CCTGACTCCCGTCAGGAGGATGG + Intronic
1084590877 11:70089537-70089559 CCAGACCTCAGGAAGGTGAAAGG - Intronic
1085026557 11:73239902-73239924 CCTGCCTCCTGCAAGGTGGAGGG + Intergenic
1085619610 11:78027956-78027978 CCTGAATTCCAAAAGGGGGAAGG + Intronic
1090433346 11:126665114-126665136 CCTCACCTCAGGCAGGTGGAAGG - Intronic
1090766238 11:129878683-129878705 GCTGACTTCCGCCAGCTGGAAGG - Intronic
1092895618 12:13007466-13007488 CCTGAATTCCAAAAGGAGGAAGG - Intergenic
1093211949 12:16318325-16318347 CCTCAGTTCCACAAGGTGGAAGG - Intergenic
1094064653 12:26350156-26350178 CCTGACTTTAGGGAGGCGGAGGG + Intronic
1101253398 12:102956327-102956349 CCAGACGTCCTGAAGCTGGACGG + Intronic
1102004819 12:109582465-109582487 CCTGTCTTTCAAAAGGTGGAGGG + Intronic
1102148016 12:110669316-110669338 CCTGGCTGCAGGCAGGTGGAGGG - Intronic
1102930340 12:116857198-116857220 CTTGACTTGTGGATGGTGGAGGG - Exonic
1103454648 12:121055408-121055430 CCTGATTTCAGGATGGAGGAGGG - Intergenic
1105411459 13:20174777-20174799 CCTGGCGTCTGGAAGGTGGCTGG + Intergenic
1112520284 13:100088986-100089008 CCTAACTTGCGGAAAGGGGAGGG - Intergenic
1113184589 13:107673374-107673396 GCTGTCTTCTGGAAGGTAGAGGG + Intronic
1120819942 14:88902821-88902843 ACAGACTTACAGAAGGTGGAGGG + Intergenic
1120878951 14:89399689-89399711 CCTTCCTTCTGGAAGGGGGAGGG + Intronic
1120898268 14:89553670-89553692 CCTGACTTCCGGATGAGCGATGG - Intronic
1121425011 14:93844331-93844353 CCTGAATTCCAAAAGGAGGAGGG + Intergenic
1121640131 14:95479768-95479790 CCTGGCTTGAGGAAGGTGGCTGG + Intergenic
1127273500 15:57422289-57422311 TCTGACTTCCTGAGGGTGGCAGG - Intronic
1127934495 15:63623796-63623818 CCTGCCTTCCCGAGCGTGGAAGG - Exonic
1131360688 15:91788201-91788223 CATGACTTTCGGGGGGTGGAGGG - Intergenic
1133773645 16:8882259-8882281 CCTCACTTCCTGCAGGAGGAGGG - Intergenic
1138459385 16:57138937-57138959 GTTGACTTCCGGGAGGTGGTGGG + Intronic
1138677469 16:58662191-58662213 CCTGACTCCCAGGAGGTGGCAGG + Intergenic
1141343295 16:83223265-83223287 CCTGTCTTCTGGAGGGTGCAAGG - Intronic
1142786872 17:2231364-2231386 CCTGAATTACAGAAGGTAGAGGG - Intronic
1143473420 17:7190353-7190375 CCTGACTTCTGGAATGTGTGTGG + Exonic
1143506195 17:7366957-7366979 CCTGGCTTGTGGATGGTGGAAGG + Intergenic
1143997879 17:11023769-11023791 CCTGGCTTCTGGAGGGGGGAGGG - Intergenic
1145290638 17:21542802-21542824 CCTGAACTCAGGAAGGTGAAGGG - Intronic
1145933085 17:28699909-28699931 CCTGACTTCAGGGACGTGGCTGG + Intronic
1146561168 17:33871705-33871727 CCTGAATTACGGGAGGAGGAGGG + Intronic
1148323342 17:46770401-46770423 CTGGACTTTGGGAAGGTGGAGGG - Intronic
1148798709 17:50210055-50210077 CCTGAGGCCCAGAAGGTGGAGGG + Intergenic
1151325730 17:73378937-73378959 CCTGCCCTCAGGAAGCTGGAGGG + Intronic
1151584683 17:75001976-75001998 CCTGGCTCCCTGAAGATGGAGGG - Intronic
1154083701 18:11281602-11281624 CCTCACCTCCAGAAGGTGTAGGG - Intergenic
1155958109 18:31970964-31970986 TCTGACTTTCAGAAGGAGGATGG - Intergenic
1157370489 18:47106639-47106661 CCTGACTTCAGGATGGGGCAAGG - Intergenic
1157758693 18:50242532-50242554 CCTGACTTCCCGAAACTGTATGG + Intronic
1157876886 18:51282072-51282094 CCTGAATTCCAAAAGGAGGAGGG + Intergenic
1160543740 18:79639303-79639325 CCTGAATTCCAGAGGGAGGAGGG - Intergenic
1163222955 19:15934872-15934894 CCTGATTTCCGGAAGGCTGTGGG + Intergenic
1164030047 19:21395656-21395678 TCTGACGTCAGGAAGGTGAAGGG - Intergenic
1166384287 19:42371516-42371538 CCTGACCTCCACAAGGTGTAGGG - Intronic
1167465157 19:49646700-49646722 CCTCACTTCTGCAAGGCGGAAGG - Exonic
1167754673 19:51404721-51404743 CCTCTCTTATGGAAGGTGGAAGG + Intergenic
925174314 2:1771537-1771559 CCTGTTTTCCGGGAGGAGGAGGG - Intergenic
929270981 2:39971367-39971389 CCTGACTGACGGACGGTAGATGG - Intergenic
931292010 2:60881603-60881625 CCTGGCTCCCGTACGGTGGACGG + Exonic
932226706 2:70047032-70047054 CCTGACTTCAGGAAGAAGCAAGG + Intergenic
935130541 2:100257933-100257955 CCTGGCATCTGGAAGGTGGAGGG - Intergenic
940136974 2:150447990-150448012 CCTGACCTCCAGAAAGAGGAGGG - Intergenic
941857796 2:170248209-170248231 CCTTCCTTCCGGAAGGGTGAAGG + Intronic
944986819 2:205187003-205187025 CCTGTCTTCAGGAAGCTGGTAGG + Intronic
945746806 2:213728325-213728347 CCTGACTGCAGAAAGGTAGAAGG - Intronic
945960824 2:216133094-216133116 CCTCACTTCTGGAAGGTAGCTGG + Intronic
947537628 2:230950778-230950800 CCTGCCTTGCGGCAGGTGAAAGG - Intronic
948088093 2:235267318-235267340 CGTGAGCTCAGGAAGGTGGAGGG - Intergenic
1170244308 20:14204099-14204121 CCAGGCTTCCTGAAGGTGCATGG + Intronic
1171165207 20:22964178-22964200 CCTGAATTCCAAAAGGAGGAGGG + Intergenic
1174896854 20:54458377-54458399 TATGACATCAGGAAGGTGGAAGG + Intergenic
1181807635 22:25384543-25384565 CCTGACTTCAGGGAGGAGGGCGG + Intronic
1182447197 22:30396883-30396905 TCTGACTTCAGGAGGGCGGAGGG + Exonic
1184373940 22:44099895-44099917 ACCGCCTTCTGGAAGGTGGATGG - Intronic
1184865272 22:47198779-47198801 CATGCCTTTCGGAAGGTGCAGGG + Intergenic
1185060336 22:48603234-48603256 CCTCAGTTCCGGTAGGGGGAGGG + Intronic
1185408517 22:50671258-50671280 CCTGAGGTCCTGAAGGTGGGTGG + Intergenic
949586100 3:5439319-5439341 CGTGACATCCTGAAGGAGGATGG + Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
955068797 3:55555036-55555058 GCTGACTTCCCCAAGGTGGCTGG - Intronic
957496389 3:80996526-80996548 CCTGAATTCCCTAAGGTGAATGG - Intergenic
959942178 3:112091476-112091498 CCTAACTCCCGAAAGGTGGGAGG + Intronic
966282676 3:178251270-178251292 ATGGACATCCGGAAGGTGGAGGG + Intergenic
966643654 3:182218416-182218438 TCTGAATTCCGGAAGGTTGGTGG + Intergenic
968574644 4:1359961-1359983 TCTGACTTCCAGGAGGTGAAAGG + Intronic
969566267 4:7980237-7980259 CCTGAATTCCGAAGGGAGGAGGG - Intronic
971461683 4:26905491-26905513 CCAGATTTCCTGAAGTTGGATGG + Intronic
977681321 4:99801555-99801577 CCTGAATTCCAAAAGGTGGAGGG + Intergenic
982415013 4:155120769-155120791 CCTGAATTCCAAAAGGAGGAAGG - Intergenic
982443936 4:155468436-155468458 CTTGACTACCTGAAGGTGCAGGG - Intergenic
993845618 5:92939567-92939589 CCTGACTGCCAGTGGGTGGATGG + Intergenic
994867384 5:105293650-105293672 CCTGAATTCCAAAAGGAGGAGGG - Intergenic
997248012 5:132367873-132367895 TCTTACTTCCTGAAGATGGATGG - Intergenic
997637130 5:135420429-135420451 CCTGACTTCCAGCAGTTTGATGG - Intergenic
998135562 5:139672608-139672630 CCTGAGGTCTGGAGGGTGGAGGG + Intronic
998257098 5:140596418-140596440 CCTGACTTCAGGGAGGGGAATGG - Intergenic
999481135 5:151949175-151949197 CAAGACTTCCTGAAGGAGGAAGG + Intergenic
1000955804 5:167542178-167542200 TCTGGCTTTTGGAAGGTGGAGGG - Intronic
1005671786 6:28113666-28113688 CCTGACTTCTGGAGGCTTGAAGG - Intergenic
1006897977 6:37482889-37482911 TCTGACTAGCGGAGGGTGGACGG - Intergenic
1008885182 6:56424673-56424695 CCTGACTCCTGGCTGGTGGAGGG - Intergenic
1018935811 6:168273516-168273538 CCTGGCTTCCAGGAGGAGGAAGG + Intergenic
1019545039 7:1570074-1570096 CCTGACTTCCGGAAGGTGGACGG - Intronic
1019667603 7:2259570-2259592 CCTGAGGTCTGGAGGGTGGAAGG - Intronic
1019693493 7:2431529-2431551 CCTGGCATCCACAAGGTGGAAGG - Intronic
1021860074 7:24897235-24897257 CCTGGCTTCCTGAAAGTGGCAGG + Intronic
1023404250 7:39815079-39815101 CCTGACGTCCAGAAGTTTGATGG + Intergenic
1024034511 7:45495806-45495828 CCTGAATTCCAGAGGGAGGAGGG + Intergenic
1024160611 7:46671245-46671267 CCTGAATTCCAAAGGGTGGAGGG - Intergenic
1024599040 7:50963399-50963421 GCTGACTTCTGAAGGGTGGAAGG + Intergenic
1025864956 7:65372810-65372832 CCTGACATCAGGAGGGTGAAGGG - Intergenic
1026895821 7:74009593-74009615 CCTGACTTGAGGCAGGAGGAAGG - Intergenic
1027512334 7:79098157-79098179 CCAGACTGCAGGAAGGAGGAAGG - Intronic
1029276608 7:99408808-99408830 CCTCACTTCCGGTGGGTGGCAGG - Exonic
1038310709 8:26444281-26444303 CCACAGTTCTGGAAGGTGGAAGG + Intronic
1039616110 8:38956252-38956274 CCTGACTTCTGCAAGGAAGAGGG - Intronic
1040603789 8:48910145-48910167 CGTGACTTCCAGGAGGTGGGTGG - Intergenic
1041466122 8:58159267-58159289 GCTGCCTTCTGGGAGGTGGAGGG - Intronic
1041842486 8:62288389-62288411 CCTGTCGTCAGGTAGGTGGAGGG - Intronic
1044932768 8:97265770-97265792 CATGCCTTCAGGAAGGAGGAAGG - Intergenic
1045221139 8:100201676-100201698 CCTGCCTTGGGGAAGGTGAAAGG - Intronic
1045644272 8:104284920-104284942 CCTGAATTCCAAAGGGTGGAGGG + Intergenic
1047665040 8:127082319-127082341 CCTCACTTATGGAAGGTGGGAGG - Intergenic
1049501968 8:142971733-142971755 CCTGACCTCCTGCAGGTGGTGGG - Intergenic
1050014828 9:1222454-1222476 CCTCACTTGGTGAAGGTGGAAGG - Intergenic
1050704989 9:8386669-8386691 CCAGACTTCAGGAACGTGGTGGG - Intronic
1056262519 9:84862946-84862968 CCTCACATCTGGAAGGTGGTTGG + Intronic
1056643888 9:88393535-88393557 CTTGACTCCCGGGAGGTGGAGGG - Intronic
1058045494 9:100352920-100352942 CCTGATTTCCGGGCGGCGGAAGG - Exonic
1059567701 9:115399748-115399770 GCTGACTCCCGGAAGTGGGAAGG + Intronic
1060042142 9:120308844-120308866 CCTGACTTCCTGGGGGTGGGGGG + Intergenic
1062035281 9:134380137-134380159 CCTGACTTGCCGCTGGTGGACGG - Intronic
1185549653 X:972989-973011 CCAGAGTTCCGGGACGTGGAAGG + Intergenic
1186767873 X:12790385-12790407 CCTGACTCCAGGGATGTGGAGGG + Intergenic
1187397953 X:18934416-18934438 CCTGAGCTCCGGAATGTTGATGG - Intronic
1189514098 X:41693769-41693791 CCAGAATTCAGGAAAGTGGAGGG - Intronic
1192146331 X:68685439-68685461 CCTGACTTGGGGATGGTGGGGGG - Intronic
1202008054 Y:20300150-20300172 CCTTACTTCCGGGAGGTTCATGG + Intergenic