ID: 1019550589

View in Genome Browser
Species Human (GRCh38)
Location 7:1600247-1600269
Sequence GACGTGAGCCACGGAGGACT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019550589_1019550595 8 Left 1019550589 7:1600247-1600269 CCGAGTCCTCCGTGGCTCACGTC No data
Right 1019550595 7:1600278-1600300 ACCTGATCTGCTCGTGAGCTTGG No data
1019550589_1019550597 22 Left 1019550589 7:1600247-1600269 CCGAGTCCTCCGTGGCTCACGTC No data
Right 1019550597 7:1600292-1600314 TGAGCTTGGCAAGCATCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019550589 Original CRISPR GACGTGAGCCACGGAGGACT CGG (reversed) Intergenic
No off target data available for this crispr