ID: 1019553930

View in Genome Browser
Species Human (GRCh38)
Location 7:1619421-1619443
Sequence CGTTCTTACCAACGCACTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019553930_1019553941 19 Left 1019553930 7:1619421-1619443 CCCCAAGTGCGTTGGTAAGAACG No data
Right 1019553941 7:1619463-1619485 GCTGGAACCGTCTGAGCGGCGGG No data
1019553930_1019553938 1 Left 1019553930 7:1619421-1619443 CCCCAAGTGCGTTGGTAAGAACG No data
Right 1019553938 7:1619445-1619467 GAGGAGGGGAGAAGGACAGCTGG No data
1019553930_1019553942 20 Left 1019553930 7:1619421-1619443 CCCCAAGTGCGTTGGTAAGAACG No data
Right 1019553942 7:1619464-1619486 CTGGAACCGTCTGAGCGGCGGGG No data
1019553930_1019553940 18 Left 1019553930 7:1619421-1619443 CCCCAAGTGCGTTGGTAAGAACG No data
Right 1019553940 7:1619462-1619484 AGCTGGAACCGTCTGAGCGGCGG No data
1019553930_1019553943 21 Left 1019553930 7:1619421-1619443 CCCCAAGTGCGTTGGTAAGAACG No data
Right 1019553943 7:1619465-1619487 TGGAACCGTCTGAGCGGCGGGGG No data
1019553930_1019553937 -7 Left 1019553930 7:1619421-1619443 CCCCAAGTGCGTTGGTAAGAACG No data
Right 1019553937 7:1619437-1619459 AAGAACGCGAGGAGGGGAGAAGG No data
1019553930_1019553945 27 Left 1019553930 7:1619421-1619443 CCCCAAGTGCGTTGGTAAGAACG No data
Right 1019553945 7:1619471-1619493 CGTCTGAGCGGCGGGGGAGCCGG No data
1019553930_1019553939 15 Left 1019553930 7:1619421-1619443 CCCCAAGTGCGTTGGTAAGAACG No data
Right 1019553939 7:1619459-1619481 GACAGCTGGAACCGTCTGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019553930 Original CRISPR CGTTCTTACCAACGCACTTG GGG (reversed) Intergenic
No off target data available for this crispr