ID: 1019553931

View in Genome Browser
Species Human (GRCh38)
Location 7:1619422-1619444
Sequence GCGTTCTTACCAACGCACTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019553931_1019553937 -8 Left 1019553931 7:1619422-1619444 CCCAAGTGCGTTGGTAAGAACGC No data
Right 1019553937 7:1619437-1619459 AAGAACGCGAGGAGGGGAGAAGG No data
1019553931_1019553943 20 Left 1019553931 7:1619422-1619444 CCCAAGTGCGTTGGTAAGAACGC No data
Right 1019553943 7:1619465-1619487 TGGAACCGTCTGAGCGGCGGGGG No data
1019553931_1019553945 26 Left 1019553931 7:1619422-1619444 CCCAAGTGCGTTGGTAAGAACGC No data
Right 1019553945 7:1619471-1619493 CGTCTGAGCGGCGGGGGAGCCGG No data
1019553931_1019553938 0 Left 1019553931 7:1619422-1619444 CCCAAGTGCGTTGGTAAGAACGC No data
Right 1019553938 7:1619445-1619467 GAGGAGGGGAGAAGGACAGCTGG No data
1019553931_1019553942 19 Left 1019553931 7:1619422-1619444 CCCAAGTGCGTTGGTAAGAACGC No data
Right 1019553942 7:1619464-1619486 CTGGAACCGTCTGAGCGGCGGGG No data
1019553931_1019553941 18 Left 1019553931 7:1619422-1619444 CCCAAGTGCGTTGGTAAGAACGC No data
Right 1019553941 7:1619463-1619485 GCTGGAACCGTCTGAGCGGCGGG No data
1019553931_1019553940 17 Left 1019553931 7:1619422-1619444 CCCAAGTGCGTTGGTAAGAACGC No data
Right 1019553940 7:1619462-1619484 AGCTGGAACCGTCTGAGCGGCGG No data
1019553931_1019553939 14 Left 1019553931 7:1619422-1619444 CCCAAGTGCGTTGGTAAGAACGC No data
Right 1019553939 7:1619459-1619481 GACAGCTGGAACCGTCTGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019553931 Original CRISPR GCGTTCTTACCAACGCACTT GGG (reversed) Intergenic
No off target data available for this crispr