ID: 1019553945

View in Genome Browser
Species Human (GRCh38)
Location 7:1619471-1619493
Sequence CGTCTGAGCGGCGGGGGAGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019553931_1019553945 26 Left 1019553931 7:1619422-1619444 CCCAAGTGCGTTGGTAAGAACGC No data
Right 1019553945 7:1619471-1619493 CGTCTGAGCGGCGGGGGAGCCGG No data
1019553930_1019553945 27 Left 1019553930 7:1619421-1619443 CCCCAAGTGCGTTGGTAAGAACG No data
Right 1019553945 7:1619471-1619493 CGTCTGAGCGGCGGGGGAGCCGG No data
1019553932_1019553945 25 Left 1019553932 7:1619423-1619445 CCAAGTGCGTTGGTAAGAACGCG No data
Right 1019553945 7:1619471-1619493 CGTCTGAGCGGCGGGGGAGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019553945 Original CRISPR CGTCTGAGCGGCGGGGGAGC CGG Intergenic
No off target data available for this crispr