ID: 1019554608

View in Genome Browser
Species Human (GRCh38)
Location 7:1622644-1622666
Sequence AGGCGTGTGAAGTAAGGTAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019554598_1019554608 -5 Left 1019554598 7:1622626-1622648 CCCCCGCCCCAGGAAGTGAGGCG No data
Right 1019554608 7:1622644-1622666 AGGCGTGTGAAGTAAGGTAGGGG No data
1019554590_1019554608 21 Left 1019554590 7:1622600-1622622 CCGTGAGACCTCTCTGCCCTCAG No data
Right 1019554608 7:1622644-1622666 AGGCGTGTGAAGTAAGGTAGGGG No data
1019554592_1019554608 13 Left 1019554592 7:1622608-1622630 CCTCTCTGCCCTCAGGTCCCCCC No data
Right 1019554608 7:1622644-1622666 AGGCGTGTGAAGTAAGGTAGGGG No data
1019554588_1019554608 26 Left 1019554588 7:1622595-1622617 CCGACCCGTGAGACCTCTCTGCC No data
Right 1019554608 7:1622644-1622666 AGGCGTGTGAAGTAAGGTAGGGG No data
1019554601_1019554608 -8 Left 1019554601 7:1622629-1622651 CCGCCCCAGGAAGTGAGGCGTGT No data
Right 1019554608 7:1622644-1622666 AGGCGTGTGAAGTAAGGTAGGGG No data
1019554600_1019554608 -7 Left 1019554600 7:1622628-1622650 CCCGCCCCAGGAAGTGAGGCGTG No data
Right 1019554608 7:1622644-1622666 AGGCGTGTGAAGTAAGGTAGGGG No data
1019554595_1019554608 4 Left 1019554595 7:1622617-1622639 CCTCAGGTCCCCCCGCCCCAGGA No data
Right 1019554608 7:1622644-1622666 AGGCGTGTGAAGTAAGGTAGGGG No data
1019554589_1019554608 22 Left 1019554589 7:1622599-1622621 CCCGTGAGACCTCTCTGCCCTCA No data
Right 1019554608 7:1622644-1622666 AGGCGTGTGAAGTAAGGTAGGGG No data
1019554597_1019554608 -4 Left 1019554597 7:1622625-1622647 CCCCCCGCCCCAGGAAGTGAGGC No data
Right 1019554608 7:1622644-1622666 AGGCGTGTGAAGTAAGGTAGGGG No data
1019554599_1019554608 -6 Left 1019554599 7:1622627-1622649 CCCCGCCCCAGGAAGTGAGGCGT No data
Right 1019554608 7:1622644-1622666 AGGCGTGTGAAGTAAGGTAGGGG No data
1019554593_1019554608 5 Left 1019554593 7:1622616-1622638 CCCTCAGGTCCCCCCGCCCCAGG No data
Right 1019554608 7:1622644-1622666 AGGCGTGTGAAGTAAGGTAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019554608 Original CRISPR AGGCGTGTGAAGTAAGGTAG GGG Intergenic
No off target data available for this crispr