ID: 1019557531

View in Genome Browser
Species Human (GRCh38)
Location 7:1640141-1640163
Sequence CTGTGACGCCACCACTGCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019557531_1019557533 2 Left 1019557531 7:1640141-1640163 CCAGTGCAGTGGTGGCGTCACAG No data
Right 1019557533 7:1640166-1640188 CACTGCAACCTCACCCTCCAGGG No data
1019557531_1019557532 1 Left 1019557531 7:1640141-1640163 CCAGTGCAGTGGTGGCGTCACAG No data
Right 1019557532 7:1640165-1640187 TCACTGCAACCTCACCCTCCAGG 0: 17
1: 2608
2: 131483
3: 195263
4: 121926

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019557531 Original CRISPR CTGTGACGCCACCACTGCAC TGG (reversed) Intergenic
No off target data available for this crispr