ID: 1019558349

View in Genome Browser
Species Human (GRCh38)
Location 7:1643576-1643598
Sequence CTGGGGACTCAGAGGGAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019558337_1019558349 14 Left 1019558337 7:1643539-1643561 CCTGCACACCTTTCTTGGTTGCA No data
Right 1019558349 7:1643576-1643598 CTGGGGACTCAGAGGGAATGGGG No data
1019558334_1019558349 23 Left 1019558334 7:1643530-1643552 CCACTGTACCCTGCACACCTTTC No data
Right 1019558349 7:1643576-1643598 CTGGGGACTCAGAGGGAATGGGG No data
1019558336_1019558349 15 Left 1019558336 7:1643538-1643560 CCCTGCACACCTTTCTTGGTTGC No data
Right 1019558349 7:1643576-1643598 CTGGGGACTCAGAGGGAATGGGG No data
1019558338_1019558349 6 Left 1019558338 7:1643547-1643569 CCTTTCTTGGTTGCAGTGCACAG No data
Right 1019558349 7:1643576-1643598 CTGGGGACTCAGAGGGAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019558349 Original CRISPR CTGGGGACTCAGAGGGAATG GGG Intergenic
No off target data available for this crispr