ID: 1019559463

View in Genome Browser
Species Human (GRCh38)
Location 7:1648745-1648767
Sequence CGGGCTGAGGATTCAGGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019559463_1019559470 16 Left 1019559463 7:1648745-1648767 CCTTCTCCTGAATCCTCAGCCCG No data
Right 1019559470 7:1648784-1648806 TCATCTCCCTGTGTCCTCACCGG 0: 4
1: 52
2: 98
3: 171
4: 547
1019559463_1019559471 17 Left 1019559463 7:1648745-1648767 CCTTCTCCTGAATCCTCAGCCCG No data
Right 1019559471 7:1648785-1648807 CATCTCCCTGTGTCCTCACCGGG No data
1019559463_1019559467 -9 Left 1019559463 7:1648745-1648767 CCTTCTCCTGAATCCTCAGCCCG No data
Right 1019559467 7:1648759-1648781 CTCAGCCCGTGGCTTGCAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019559463 Original CRISPR CGGGCTGAGGATTCAGGAGA AGG (reversed) Intergenic
No off target data available for this crispr