ID: 1019559781

View in Genome Browser
Species Human (GRCh38)
Location 7:1650304-1650326
Sequence CAGAAAATGGGGCAGCTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019559781_1019559790 9 Left 1019559781 7:1650304-1650326 CCCAGTAGCTGCCCCATTTTCTG No data
Right 1019559790 7:1650336-1650358 GTGCTTTCATGGAGGCCCAGGGG No data
1019559781_1019559788 7 Left 1019559781 7:1650304-1650326 CCCAGTAGCTGCCCCATTTTCTG No data
Right 1019559788 7:1650334-1650356 TCGTGCTTTCATGGAGGCCCAGG No data
1019559781_1019559787 1 Left 1019559781 7:1650304-1650326 CCCAGTAGCTGCCCCATTTTCTG No data
Right 1019559787 7:1650328-1650350 ATGAATTCGTGCTTTCATGGAGG No data
1019559781_1019559789 8 Left 1019559781 7:1650304-1650326 CCCAGTAGCTGCCCCATTTTCTG No data
Right 1019559789 7:1650335-1650357 CGTGCTTTCATGGAGGCCCAGGG No data
1019559781_1019559792 14 Left 1019559781 7:1650304-1650326 CCCAGTAGCTGCCCCATTTTCTG No data
Right 1019559792 7:1650341-1650363 TTCATGGAGGCCCAGGGGCCGGG No data
1019559781_1019559791 13 Left 1019559781 7:1650304-1650326 CCCAGTAGCTGCCCCATTTTCTG No data
Right 1019559791 7:1650340-1650362 TTTCATGGAGGCCCAGGGGCCGG No data
1019559781_1019559795 28 Left 1019559781 7:1650304-1650326 CCCAGTAGCTGCCCCATTTTCTG No data
Right 1019559795 7:1650355-1650377 GGGGCCGGGCAGCACAAGTCAGG No data
1019559781_1019559786 -2 Left 1019559781 7:1650304-1650326 CCCAGTAGCTGCCCCATTTTCTG No data
Right 1019559786 7:1650325-1650347 TGCATGAATTCGTGCTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019559781 Original CRISPR CAGAAAATGGGGCAGCTACT GGG (reversed) Intergenic
No off target data available for this crispr