ID: 1019564407

View in Genome Browser
Species Human (GRCh38)
Location 7:1672265-1672287
Sequence GTGGCAGTCCTGGGGCATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019564407_1019564414 9 Left 1019564407 7:1672265-1672287 CCACCATGCCCCAGGACTGCCAC No data
Right 1019564414 7:1672297-1672319 CTGATTTTTCAAAGTGTCTTTGG No data
1019564407_1019564416 16 Left 1019564407 7:1672265-1672287 CCACCATGCCCCAGGACTGCCAC No data
Right 1019564416 7:1672304-1672326 TTCAAAGTGTCTTTGGAGGCAGG No data
1019564407_1019564415 12 Left 1019564407 7:1672265-1672287 CCACCATGCCCCAGGACTGCCAC No data
Right 1019564415 7:1672300-1672322 ATTTTTCAAAGTGTCTTTGGAGG No data
1019564407_1019564417 30 Left 1019564407 7:1672265-1672287 CCACCATGCCCCAGGACTGCCAC No data
Right 1019564417 7:1672318-1672340 GGAGGCAGGCTCCCCACACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019564407 Original CRISPR GTGGCAGTCCTGGGGCATGG TGG (reversed) Intergenic
No off target data available for this crispr