ID: 1019566568

View in Genome Browser
Species Human (GRCh38)
Location 7:1683846-1683868
Sequence GACATTAATTTACCTACTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019566567_1019566568 24 Left 1019566567 7:1683799-1683821 CCTCTTTGTCTTTGACAATATTT No data
Right 1019566568 7:1683846-1683868 GACATTAATTTACCTACTCCAGG No data
1019566566_1019566568 28 Left 1019566566 7:1683795-1683817 CCTTCCTCTTTGTCTTTGACAAT No data
Right 1019566568 7:1683846-1683868 GACATTAATTTACCTACTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019566568 Original CRISPR GACATTAATTTACCTACTCC AGG Intergenic
No off target data available for this crispr