ID: 1019567141

View in Genome Browser
Species Human (GRCh38)
Location 7:1689928-1689950
Sequence CCAGGTGTCCAGAGGGCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 316
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 292}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019567141_1019567155 16 Left 1019567141 7:1689928-1689950 CCTTGAGCCCTCTGGACACCTGG 0: 1
1: 0
2: 2
3: 21
4: 292
Right 1019567155 7:1689967-1689989 TAGGTTAGGAATTGGGGATTGGG No data
1019567141_1019567150 2 Left 1019567141 7:1689928-1689950 CCTTGAGCCCTCTGGACACCTGG 0: 1
1: 0
2: 2
3: 21
4: 292
Right 1019567150 7:1689953-1689975 TCTGGAGAGGGCATTAGGTTAGG No data
1019567141_1019567153 10 Left 1019567141 7:1689928-1689950 CCTTGAGCCCTCTGGACACCTGG 0: 1
1: 0
2: 2
3: 21
4: 292
Right 1019567153 7:1689961-1689983 GGGCATTAGGTTAGGAATTGGGG 0: 1
1: 0
2: 2
3: 11
4: 297
1019567141_1019567151 8 Left 1019567141 7:1689928-1689950 CCTTGAGCCCTCTGGACACCTGG 0: 1
1: 0
2: 2
3: 21
4: 292
Right 1019567151 7:1689959-1689981 GAGGGCATTAGGTTAGGAATTGG No data
1019567141_1019567152 9 Left 1019567141 7:1689928-1689950 CCTTGAGCCCTCTGGACACCTGG 0: 1
1: 0
2: 2
3: 21
4: 292
Right 1019567152 7:1689960-1689982 AGGGCATTAGGTTAGGAATTGGG No data
1019567141_1019567154 15 Left 1019567141 7:1689928-1689950 CCTTGAGCCCTCTGGACACCTGG 0: 1
1: 0
2: 2
3: 21
4: 292
Right 1019567154 7:1689966-1689988 TTAGGTTAGGAATTGGGGATTGG No data
1019567141_1019567149 -3 Left 1019567141 7:1689928-1689950 CCTTGAGCCCTCTGGACACCTGG 0: 1
1: 0
2: 2
3: 21
4: 292
Right 1019567149 7:1689948-1689970 TGGCATCTGGAGAGGGCATTAGG No data
1019567141_1019567147 -10 Left 1019567141 7:1689928-1689950 CCTTGAGCCCTCTGGACACCTGG 0: 1
1: 0
2: 2
3: 21
4: 292
Right 1019567147 7:1689941-1689963 GGACACCTGGCATCTGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019567141 Original CRISPR CCAGGTGTCCAGAGGGCTCA AGG (reversed) Intronic
900195622 1:1374267-1374289 CCAGCTCTCCAGGGGGCTGACGG + Exonic
900392458 1:2439689-2439711 CCAGGTGAACAGATGGCTCAGGG - Intronic
900462952 1:2810140-2810162 CCAGGGCTCAGGAGGGCTCAGGG - Intergenic
900620791 1:3586772-3586794 CCAGGTGGGCAGAGGCCACAGGG + Intronic
900742558 1:4339520-4339542 CCACAGGTCCAGAGGGCCCAGGG + Intergenic
900900910 1:5515247-5515269 CCAGGTGTGCAGAGGCCACAAGG + Intergenic
903295933 1:22343053-22343075 CCAGGTGTCCCGAGGGCTGCTGG - Intergenic
903371933 1:22842010-22842032 CCAGCTGTCCCGAGGCCCCATGG - Intronic
904384806 1:30134382-30134404 CCAGTTCTCCCCAGGGCTCAAGG - Intergenic
904474859 1:30758123-30758145 ACAGCTGTCCAGAGAGGTCAAGG + Intergenic
904606123 1:31698665-31698687 TCAGCAGTCCTGAGGGCTCAGGG - Intronic
905253873 1:36667396-36667418 CCAGCTGACCAGAGGTCTCAGGG - Intergenic
907244824 1:53102175-53102197 CCAGGTGTGCAGAGGGGCCGGGG - Intronic
909639852 1:77860616-77860638 CTAGGTGTGCAAATGGCTCAAGG - Intronic
912961697 1:114201709-114201731 CCCGGTGTCCAGAGTGGGCAGGG - Intergenic
914674656 1:149899506-149899528 CGTGGTGCCCTGAGGGCTCATGG - Exonic
915277926 1:154802437-154802459 CCAGGTGTTCAGTGACCTCAGGG + Intronic
917738438 1:177940720-177940742 CCAGGTTTCCAGATGGGTTAGGG + Intronic
919779607 1:201213479-201213501 CAAGGTGACCAGGGGGCTCCCGG - Exonic
919851524 1:201676215-201676237 CCAGGTCTCCAGAGTCCCCAGGG - Intronic
919978996 1:202630738-202630760 CCAGGACACCAGAGGCCTCAAGG + Intronic
920848322 1:209611697-209611719 CCAGGTTTCAAGAGGCCACAAGG + Intronic
922730151 1:227945410-227945432 CCTGGTGGCCAGAGGCCTCTAGG + Intronic
922813112 1:228429139-228429161 CCAGGTGTCCTTAGGGCTAACGG + Intergenic
923546408 1:234926819-234926841 GCAGGTGTCCGGTGGGGTCAGGG + Intergenic
1063987935 10:11527097-11527119 GCAGGTGTACAGAGTGCTGAGGG + Intronic
1065605546 10:27414070-27414092 CCAGGGGTCCTGAGGGTTCGGGG + Exonic
1069072617 10:64005294-64005316 CCAAGTGTGCAGAAGGCTCTGGG - Intergenic
1069609172 10:69761230-69761252 CCAGGCTTGCACAGGGCTCAGGG - Intergenic
1069861344 10:71473556-71473578 CCTGGTATCCAGAGGTCCCAGGG + Intronic
1069914242 10:71777628-71777650 TCAGGTGGCCAGAGGGACCAAGG - Intronic
1070207667 10:74279911-74279933 CCAGCTATTCAGAAGGCTCAGGG + Intronic
1071436021 10:85648802-85648824 CAAGGTGTGGAGAGGGCACAGGG - Intronic
1071997257 10:91161404-91161426 CCAGGAGTCAAGAAGGGTCAGGG + Intergenic
1072556199 10:96515561-96515583 CCAGGTCTCCAGATGGCACTAGG + Intergenic
1075070757 10:119318585-119318607 CCAGGTGATCACAGGGCTCTGGG + Intronic
1075071955 10:119325619-119325641 CCATGTGGCCAGAGGGCTCCTGG - Intronic
1075520830 10:123142722-123142744 CCAGGTGCCCCGCGGGCGCAAGG - Intergenic
1076548380 10:131261004-131261026 ACAGGTTTCCAGAGGGCACCAGG + Intronic
1076704013 10:132291408-132291430 GGAGGTGTCCACAGGGCTCCTGG - Intronic
1076755825 10:132571125-132571147 GAAGGTGTCCAAAGGGCCCAGGG - Intronic
1076874948 10:133211294-133211316 CCATGTGTGCAGGGGGCTTAGGG - Intronic
1077339826 11:2021320-2021342 CGAGGTGGCCAGAGGGGTCTGGG + Intergenic
1077555835 11:3225621-3225643 CCTAATGTCCTGAGGGCTCAAGG + Intergenic
1077608933 11:3631984-3632006 CCAGGAGGCCAGAGAGCTCTAGG + Intergenic
1078364313 11:10693768-10693790 CCAGCTGGCCTCAGGGCTCAGGG + Intronic
1080692596 11:34570947-34570969 CCAGATGCCAAGAGGCCTCAGGG - Intergenic
1080827242 11:35858772-35858794 TCAGGTGACCAGAGGACTCTAGG - Intergenic
1081682649 11:45019165-45019187 CCACGTGTCCCCAGGCCTCAGGG - Intergenic
1083127877 11:60590846-60590868 CCAAGTCTCCAGAGGACCCAGGG + Intergenic
1083162971 11:60867142-60867164 CCAGTGGTCCTGAGGCCTCAAGG + Intergenic
1083628015 11:64081904-64081926 CCGGGAGTCCAGAGGGCTGCAGG - Intronic
1084121311 11:67070632-67070654 CCAGGTGTCCAGAACGCTCAGGG + Intronic
1084288443 11:68146671-68146693 CCATGTGGCTGGAGGGCTCAGGG + Intergenic
1084461565 11:69299249-69299271 CCAGGTGTCCACAGGGAGCCCGG + Intronic
1085958210 11:81427211-81427233 CCAGGTGACAAGATGGCTAAGGG + Intergenic
1088676501 11:112198740-112198762 CTAGGGGTCCAGAGGGCTGGAGG + Intronic
1088895195 11:114073127-114073149 CTGGGTGACCAGGGGGCTCATGG + Intronic
1089326450 11:117660672-117660694 CCAGCTGCCGAGAGGGGTCAGGG + Intronic
1089462436 11:118661023-118661045 CCAGGATTGCAGAGGGCTCTCGG + Intronic
1089980964 11:122772219-122772241 CAGGGTGTCAAGAGAGCTCACGG - Intronic
1091237709 11:134033046-134033068 CCAGGGGTGGAGAGGGCTCTGGG - Intergenic
1202822811 11_KI270721v1_random:76509-76531 CGAGGTGGCCAGAGGGGTCTGGG + Intergenic
1091835760 12:3584408-3584430 CCAGGTGAAGAGATGGCTCAGGG - Intronic
1091887096 12:4024854-4024876 CCAGGTCTCCAGGGGTTTCAGGG - Intergenic
1092104752 12:5913414-5913436 CCCAGAGTCCAGTGGGCTCACGG + Intronic
1092170404 12:6370655-6370677 CCTGGTGTCCAGACTGCCCAGGG + Intronic
1099635632 12:85207087-85207109 CCAGGATTCCAGAGGTCTTACGG + Intronic
1104967158 12:132513535-132513557 AGAGGTGACCAGAGGGCTGATGG - Intronic
1105284416 13:18992967-18992989 CCAGATGGCCAGAAGGCACAAGG + Intergenic
1106340651 13:28823588-28823610 CCAGTTGAGAAGAGGGCTCAGGG - Intronic
1106435612 13:29720881-29720903 CCTGGTGGACAGTGGGCTCAGGG - Intergenic
1107779031 13:43879269-43879291 GCAGGTCTCCAGAGGGCACGGGG - Exonic
1109267013 13:60213026-60213048 CCAGGAGTCCAGAGGGTTTTGGG - Intergenic
1111854534 13:93621168-93621190 CCAGGTTGCCAGAGCCCTCAAGG + Intronic
1111947326 13:94679562-94679584 CCAGGTTTCCAGGGGGGTCTTGG - Intergenic
1112361540 13:98723556-98723578 CCAGGTGTCCTCAGGACTCCAGG - Intronic
1113823429 13:113231897-113231919 ACAGGTGTGCAGAGGGCCCTGGG - Intronic
1114182335 14:20377474-20377496 CTAGGTTCCCAGGGGGCTCAGGG - Exonic
1114527840 14:23377476-23377498 AGAGGTGTCCAGAGGGCTTGGGG - Intronic
1114602427 14:23967505-23967527 CCAGGTGGAGAGAGGACTCAGGG - Intronic
1114606796 14:24004631-24004653 CCAGGTGGAGAGAGGACTCAGGG - Intronic
1114612097 14:24049579-24049601 CCAGGTGGAGAGAGGACTCAGGG - Intergenic
1116388321 14:44359922-44359944 CCAGGTGTCAAGAGGCTGCAAGG + Intergenic
1118877700 14:69798478-69798500 GCAGGATTCCAGAGGCCTCAAGG - Intergenic
1122389623 14:101371273-101371295 CCAGCTGTCCCGAGGTCTCCAGG - Intergenic
1122427707 14:101621280-101621302 CCAGGTGTCCAGAGGTACCCTGG + Intergenic
1122480051 14:102041394-102041416 AGGCGTGTCCAGAGGGCTCACGG + Intronic
1122820527 14:104342565-104342587 CTAGGGGCCCAGATGGCTCAGGG + Intergenic
1123922958 15:25083465-25083487 ACATGTGTCCAGGGGCCTCATGG - Intergenic
1124494593 15:30178624-30178646 CCAGGACACCAGAGGCCTCAAGG + Intergenic
1124748977 15:32360021-32360043 CCAGGACACCAGAGGCCTCAAGG - Intergenic
1125087561 15:35748143-35748165 CCATGTGTGCACAGGGCCCAGGG + Intergenic
1125501422 15:40242156-40242178 CCTGGGGTCCTGAGGGCTCAGGG + Intronic
1125578535 15:40770485-40770507 CCAGGTCTCCATGGGGCCCAGGG - Exonic
1126212974 15:46120593-46120615 CCAGGTGGCCACAGGGCTTATGG + Intergenic
1128370104 15:67034083-67034105 CCAAGAGATCAGAGGGCTCAGGG - Intergenic
1132567644 16:630707-630729 CCTGGGGTCCAGAGGGCGCCAGG + Intronic
1132589086 16:718572-718594 CCAGGTGTCCACAGAGGGCATGG - Exonic
1132592711 16:733256-733278 CCAGGAGGCTTGAGGGCTCAGGG + Intronic
1132772529 16:1572164-1572186 CCAGGTGGGCAGAGGCCACAGGG + Intronic
1133040558 16:3058197-3058219 CCAGCTGTCCGGAGGGCTGGAGG - Exonic
1134063182 16:11211169-11211191 CCAGGTGCCCTGAGGGCTCCTGG + Intergenic
1134810581 16:17163677-17163699 CCAGGTGTGCACAGAGCCCAGGG + Intronic
1135671409 16:24378637-24378659 CCAGGTGTCCCAAGGGCTAAAGG + Intergenic
1136230439 16:28882673-28882695 CCAGGTGTCCAGGAGGATGACGG + Intronic
1137624686 16:49900192-49900214 CCAGGGGCCCAGAGGGCACCTGG - Intergenic
1138551828 16:57752699-57752721 CGAGGAATCCAGAGGGCCCAGGG - Intronic
1140548605 16:75837815-75837837 TCAGAGGTTCAGAGGGCTCAAGG - Intergenic
1142638274 17:1270944-1270966 CCAGGTGTCCGCAGGGCCCGCGG - Exonic
1142805462 17:2368998-2369020 CCAGGGGTCCAGAGGCCTCAGGG + Intronic
1142980068 17:3666543-3666565 GCAGGTGTCCAGAAGGCAGATGG + Intronic
1143407401 17:6686498-6686520 CCAGGTATCCTCAGTGCTCAAGG + Intronic
1146634595 17:34494677-34494699 CCAGGTGACCAGAAGGAGCAGGG + Intergenic
1146937478 17:36821266-36821288 CAATGTGTCCAGAGGCCACAGGG - Intergenic
1147555195 17:41474540-41474562 CTGGGAGTGCAGAGGGCTCAGGG - Intergenic
1147636116 17:41965512-41965534 GCTGGTGTTCAGAGGGATCATGG + Exonic
1148074659 17:44928426-44928448 CCAGGGGTCCCGATGGCCCATGG - Exonic
1148219268 17:45850446-45850468 TCAGGTGTACCCAGGGCTCAGGG - Intergenic
1148856281 17:50580806-50580828 ACAGCTGTCCAGCGGGCTCAGGG + Intronic
1150288969 17:63970998-63971020 CCACGTGACCAGAGGGCAGATGG - Intronic
1150502801 17:65667291-65667313 CCAGAACTCCAGAGGGCTAATGG + Intronic
1152233685 17:79127381-79127403 GCAGGTGTCCAGAGCGGTGAGGG + Intronic
1153360496 18:4190347-4190369 CCAGGGGTTCAGAAGGTTCAGGG + Intronic
1157359554 18:46964757-46964779 CCAGGGGCCCAGGGGGGTCAGGG - Intronic
1157361148 18:47024276-47024298 CCAGGGGCCCAGGGGGGTCAGGG - Intronic
1157362138 18:47030191-47030213 CCAGGGGCCCAGGGGGGTCAGGG - Intronic
1158955693 18:62535654-62535676 CCAAGTGTCCAGGAGGCCCAGGG + Intronic
1159148939 18:64494993-64495015 CCAGGTGGACAGAGAGCTGAGGG + Intergenic
1160036312 18:75304803-75304825 CCAGGTGTCGTGAGGGTCCAGGG + Intergenic
1160772708 19:840300-840322 CCCGATGTCCACAGGGCCCAGGG - Intergenic
1161006011 19:1937218-1937240 ACAGGTGACCTGAGGACTCACGG + Intergenic
1161356183 19:3820683-3820705 CCAGGGGTCAAGGGGACTCAGGG + Intronic
1161474315 19:4475658-4475680 CCATGTGTCCACAGTGCCCAGGG - Intronic
1161481576 19:4513428-4513450 CACGGTGTCCACTGGGCTCACGG - Exonic
1161588467 19:5118047-5118069 CCAAGTGTCCCGAGGGAGCATGG + Intronic
1161731039 19:5960809-5960831 CCGTGTGTCCAGAAGGCTCCGGG - Intronic
1163275216 19:16279329-16279351 CCATGTATCCAGATGACTCATGG + Intergenic
1163507415 19:17716421-17716443 CCAGCAGTCCTGAGGGCTCAGGG + Intergenic
1163604233 19:18265404-18265426 ACAGGTGTCCAGATGGGCCAGGG + Exonic
1163826675 19:19528128-19528150 CCAGGTGGCCGGAGGGCACAGGG - Exonic
1165119529 19:33550094-33550116 GCAGGTGTGCAGAGGGCTCTTGG + Intergenic
1165764737 19:38343573-38343595 CCAGGTCCTCAGAGGGCTGAGGG - Exonic
1166948474 19:46411675-46411697 CCAGCTGACCAGAGGTCACAGGG - Exonic
1167490955 19:49792413-49792435 CCAGGAATCCAGGGGGATCAGGG - Intronic
1168430094 19:56271837-56271859 CCAGGAGTCCAGAGGGATACTGG + Intronic
925001472 2:406383-406405 CCATGTGTCCTGAGGCCTGAAGG - Intergenic
925189530 2:1871579-1871601 CCAGGTGGCTAGAGGGGTGAAGG + Intronic
925213732 2:2073909-2073931 CCAGGAGGCCAGAGTGCTGAGGG - Intronic
925817609 2:7768843-7768865 CCAGGGGACCTGAGGGCACAGGG - Intergenic
926123466 2:10257161-10257183 CCAGGTCTGCAGAGGGCTTATGG + Intergenic
926158754 2:10473511-10473533 CAGGGTGTCCTGAGGACTCATGG + Intergenic
927138079 2:20111872-20111894 ACAAGTGAGCAGAGGGCTCAAGG + Intergenic
927963651 2:27256392-27256414 CCAGGTGTGCAGAGGCAACATGG + Exonic
928181683 2:29072575-29072597 CCTGGTGCCCACAGGGCACAGGG + Exonic
929307426 2:40379520-40379542 TTAGGTGACCAGAGGGTTCATGG - Intronic
929398007 2:41545699-41545721 CCAGTTGGTTAGAGGGCTCAAGG + Intergenic
929871209 2:45760847-45760869 CCTGGTGTCCAGAGGCATAAAGG + Intronic
930095168 2:47561165-47561187 CCAGGTGTGCTGAGGCCTCTTGG - Intronic
931589400 2:63865315-63865337 CCAGCTGCCTAGAGGGCTGAAGG + Intronic
934047267 2:88182998-88183020 CCAGGTGACAAGAGCCCTCATGG + Exonic
937098966 2:119254122-119254144 CCAGGAAGACAGAGGGCTCAGGG + Intronic
937204037 2:120224310-120224332 CCAGATGGCCAGAGGGCGAAAGG - Intergenic
940284298 2:152018361-152018383 TCAGGTGTGTAGAGGGCTCAGGG - Intronic
941333522 2:164210465-164210487 CAAGGTGTCCACAGGGCTGGGGG - Intergenic
941652932 2:168112863-168112885 CCAGCTGCCCTGAGGGATCAGGG + Intronic
943037844 2:182768408-182768430 CCATGTGTCCAGAGGAGTCCAGG + Intronic
945948579 2:216017597-216017619 TCAGGTGCCCAGAGGGCTCTTGG - Intronic
945957332 2:216098602-216098624 CAAGGAGTCCACAGGGCCCAAGG + Intronic
947588427 2:231370943-231370965 CCAGCTGACCAGAGCGCCCAGGG - Intronic
947613620 2:231539927-231539949 ACAAGGGTCCAGAGGGCTCCTGG + Intergenic
948141987 2:235680371-235680393 GCTGGTGTCCAGAGGGGTCAGGG + Intronic
948278109 2:236725560-236725582 GCAGCTCACCAGAGGGCTCAGGG - Intergenic
948311395 2:236989606-236989628 CCAGGTTTCCAGAGGGAACGAGG - Intergenic
948556355 2:238813978-238814000 CCCTGTGTCCAAAGCGCTCAGGG - Intergenic
948967585 2:241395534-241395556 CCAGGTGACCACAGGGATCTGGG - Intronic
1168834455 20:868821-868843 CCAGATGCCCAGAGTGCTCTGGG + Intergenic
1168956667 20:1838910-1838932 CCAGGTGCCCAAAGAACTCAGGG + Intergenic
1172174190 20:32962229-32962251 CCAGCTGCCAAGAGGGCTGATGG - Intergenic
1172621475 20:36320691-36320713 GCAGGTGGGCAAAGGGCTCAGGG - Intronic
1172895341 20:38296073-38296095 CCAGGTGCCCTGAGAGCTCTGGG + Intronic
1174480533 20:50828217-50828239 CTAGGTGTCCAGTGTCCTCAGGG - Intronic
1174508738 20:51034938-51034960 CCTGGTGTGCAGAGGGCTGCTGG - Intergenic
1175562628 20:59944137-59944159 CCAGGTGTCAGGGGGCCTCAGGG + Exonic
1175778448 20:61667373-61667395 TCATCTGTCAAGAGGGCTCATGG - Intronic
1175824950 20:61931731-61931753 CCAGGGGTCCAGAGTGAGCAAGG + Intronic
1175825333 20:61933748-61933770 CCACGTGCCCCGAGTGCTCAGGG - Intronic
1176042726 20:63073741-63073763 CCAAGTGTTCACAGGGCTCTTGG + Intergenic
1176233539 20:64043449-64043471 CCAGGCGTGCAGAAGGCGCAGGG - Intronic
1176384791 21:6133959-6133981 CCAACTGTCCAGAGGGCATAGGG + Intergenic
1176425819 21:6547625-6547647 CCAGGTGTCCACAGGCAGCAGGG + Intergenic
1179701310 21:43155942-43155964 CCAGGTGTCCACAGGCAGCAGGG + Intergenic
1179738681 21:43404293-43404315 CCAGCTGTCCAGAGGGCATAGGG - Intergenic
1179812298 21:43879875-43879897 CCAGGTGCCCAGAGGTCCTAAGG - Intronic
1180096342 21:45557006-45557028 CATGGTGTCCAGAGGCCTCTCGG - Intergenic
1181066245 22:20307425-20307447 CCGGGTGCCCAGAGGACACAGGG + Intergenic
1181992567 22:26848510-26848532 ACAGGTGAGCAGAGGGCTGAGGG + Intergenic
1182268109 22:29135174-29135196 CCTGGACTCAAGAGGGCTCAAGG + Intronic
1183733564 22:39631294-39631316 TCAGGTGTCCTGAGGACTCCAGG + Intronic
1184012113 22:41757010-41757032 CAAGGTGTTCAGAGGCCTGAAGG - Intronic
1184914270 22:47558619-47558641 CCAGGTATGCAGGGGCCTCAGGG + Intergenic
1185052926 22:48563164-48563186 CCACTTGTCCACAGGGCTCTTGG - Intronic
1185131047 22:49039063-49039085 CCAGGTGGCTGCAGGGCTCAGGG - Intergenic
950764579 3:15263923-15263945 AGAGGAGCCCAGAGGGCTCATGG + Intronic
952415887 3:33091478-33091500 ACAGGTGCCCAGAGGATTCATGG - Exonic
952901624 3:38115161-38115183 CCAGGTGTCCAGGGGGCCTGTGG + Intronic
953159218 3:40403002-40403024 CCTGTTGTCCTGTGGGCTCAAGG - Intronic
953403746 3:42649963-42649985 TCAGGAGTCCAGAGGTGTCAGGG + Intergenic
953632291 3:44629304-44629326 CCTGGGGTCCAGATGTCTCATGG - Exonic
954085392 3:48240192-48240214 TCTGGTTTCCATAGGGCTCAGGG + Intergenic
954115483 3:48464827-48464849 TCAGGTGGTCAGAGCGCTCACGG + Exonic
954118278 3:48479117-48479139 AAAGGTGACAAGAGGGCTCAGGG - Intronic
954287636 3:49630071-49630093 CCAGGGCTCCAGATGGCTCGGGG + Intronic
954409937 3:50366037-50366059 CCAGGTTGCCAGGGGGCTGAGGG + Exonic
954633840 3:52060983-52061005 CTAGGTGACTAGAGGGCTGAGGG - Intergenic
955627529 3:60934456-60934478 CCATCTGTCCAGCGGCCTCAGGG - Intronic
955693721 3:61615086-61615108 TCAAGTGTCCAGAGGGGACAGGG - Intronic
961371169 3:126432952-126432974 CCAGCTGTCCTGAGGGCTGAAGG - Intronic
961393026 3:126567913-126567935 CCAGGTGTCCAAAGAGCACATGG - Intergenic
961455659 3:127022693-127022715 CCAGCTGTCCAGCAGGCACAGGG - Intronic
961785335 3:129343936-129343958 CCAGGGGTCCAAAGGACCCATGG + Intergenic
962856964 3:139355728-139355750 CCAGATGGCCAGTCGGCTCAAGG + Exonic
965604797 3:170487184-170487206 CCAGGAGTCCACATGGCTCCAGG + Intronic
967813922 3:193783149-193783171 CCGGGAGACCAGAGGGCTCGAGG - Intergenic
967856155 3:194119066-194119088 GCAGGTGTTCAGAGGGCTAGTGG + Intergenic
968869892 4:3236493-3236515 CCATCTCTCCTGAGGGCTCAGGG + Intronic
968982991 4:3860799-3860821 CCAGGTGTCCAGTGGGGTTGTGG - Intergenic
969249345 4:5956807-5956829 GCTGGTCTCCAGAGGCCTCAGGG + Intronic
971414675 4:26413255-26413277 CCAGGTGTCCACATGGCTTTAGG + Intronic
973145665 4:46822407-46822429 CCAGGTGAGGAGAGGGCTCTGGG + Intronic
975023372 4:69518741-69518763 CCAGGGTTCCAGATGGCTTAGGG + Intronic
977681917 4:99806668-99806690 CCAGATGACCAGAGGTCCCATGG - Intergenic
983837608 4:172411673-172411695 CCAGTTGTCCTAAGGGCTGAAGG + Intronic
985812402 5:2099460-2099482 CCAGGTGTGCCGGGGTCTCAGGG - Intergenic
986758827 5:10861535-10861557 CCTGGTGTCAAGTGGGCTCCTGG + Intergenic
987383337 5:17306591-17306613 CCAGCTCTCCAGGGGGCTGATGG - Intergenic
988307814 5:29516110-29516132 CCAGCTCTCCAGGGGGCTGACGG - Intergenic
991202782 5:64013626-64013648 CCAGGGGAACAGAGTGCTCAAGG - Intergenic
996728202 5:126691411-126691433 CCAGGTCTCCATGGGTCTCAGGG - Intergenic
998914382 5:146998043-146998065 ACAAGTGTGCAGAGGGCTCCAGG + Intronic
998919397 5:147051372-147051394 CCAGTGGTCCACAGGGTTCATGG + Intronic
1001753087 5:174146402-174146424 CCAGGGCTCCAGAGAGCACAAGG + Intronic
1002602403 5:180361570-180361592 CCTGGTGTCCAGAGTCCTCCAGG + Intergenic
1002704158 5:181148962-181148984 CCAGGAGTCCACAGAGCTCTGGG + Intergenic
1005784419 6:29228393-29228415 CAAAATGTCCAGAGGGCTAAGGG + Intergenic
1007704279 6:43781452-43781474 GCTGGTGGCCAGAGGGCCCAGGG - Intronic
1008709342 6:54205037-54205059 CCAGGTGTTCAGTGGTCCCAAGG - Intronic
1017320817 6:153090877-153090899 TCAGGTGTCCACAGGGGTCTTGG + Intronic
1017422067 6:154282838-154282860 CCAGGTTTGCAGAGCGTTCATGG - Intronic
1018208402 6:161456808-161456830 CCACATGCCCAGAGAGCTCAGGG + Intronic
1018916222 6:168134179-168134201 CCATGTGTCCAGAGGACAGATGG - Intergenic
1019330864 7:460214-460236 CCAGGGGTCCAGTGGGTTCTGGG - Intergenic
1019337417 7:491920-491942 CCTGGGGTCTAGAGGTCTCATGG + Intergenic
1019405322 7:880529-880551 CCTGCTGTCTAGAGGGCTTAAGG - Intronic
1019523158 7:1469498-1469520 CCAGGTGGCGCGAGGCCTCAAGG - Intergenic
1019567141 7:1689928-1689950 CCAGGTGTCCAGAGGGCTCAAGG - Intronic
1019713342 7:2527245-2527267 CCTGGTATCCAAAGGGCCCAGGG + Exonic
1023149848 7:37191963-37191985 CCAGGTGTACTGAGGACACATGG + Intronic
1024253621 7:47523875-47523897 CCACCAGGCCAGAGGGCTCAAGG + Intronic
1025212147 7:57025898-57025920 CCAGGTGTCCACACGGCTACTGG - Intergenic
1025237517 7:57244846-57244868 CCAGGATTGCACAGGGCTCAGGG + Intergenic
1025659807 7:63550930-63550952 CCAGGTGTCCACACGGCTACTGG + Intergenic
1026874608 7:73872042-73872064 TCCTGTGTGCAGAGGGCTCATGG + Intergenic
1032586099 7:133148066-133148088 CCAGGTATCCAAAGGGATGAGGG - Intergenic
1033591208 7:142809826-142809848 CAAGCTGTCCAGAGGCCCCAGGG + Intergenic
1034643807 7:152626293-152626315 CCAGGTCTCCTGTGAGCTCAGGG + Intergenic
1035482529 7:159198743-159198765 CCAGGAGTGAAGAGGACTCAAGG + Intergenic
1035594391 8:843617-843639 CCAGGTGACCAGACAGCCCAGGG - Intergenic
1036525180 8:9528401-9528423 CCTTGTGTCCAGAGGGCTGGAGG - Intergenic
1036693149 8:10957421-10957443 CCTGGGGTCCACAGAGCTCAGGG + Intronic
1040478010 8:47797793-47797815 CACGGTGTCCAGAGGGGTCTGGG - Intronic
1042368861 8:67968157-67968179 CCAGCTGTCCACAAGCCTCAAGG - Intronic
1042740358 8:72036651-72036673 CCAGGTTAACAGAGGGCTCTGGG - Intronic
1043489934 8:80739269-80739291 TCAGGTGCTCAGATGGCTCAGGG + Intronic
1044726048 8:95195100-95195122 GAAGCTGTCCAGAGGGCTCCAGG - Intergenic
1047928285 8:129701995-129702017 CCAGCTGTCCACAGAGCTCCAGG - Intergenic
1048163139 8:132039017-132039039 GGAGGTGTCCAGAAGGTTCAGGG + Exonic
1049415820 8:142494658-142494680 CCAGGTGCTCTTAGGGCTCAGGG - Intronic
1049575478 8:143387874-143387896 CCAGGGCTCCAGGGGGCTCCTGG - Intergenic
1049853585 8:144847959-144847981 GGAGGGGTCCAGTGGGCTCATGG + Intronic
1051891212 9:21944845-21944867 GCAGGTGTCCAGGGGGTCCAGGG - Intronic
1054452532 9:65410921-65410943 CTAGGTGACCTGAGGGCTGAAGG - Intergenic
1056361567 9:85862739-85862761 CCAGCTGCCCTGAGGGCTGAGGG - Intergenic
1056576601 9:87859677-87859699 CCAGGTGTCCACTGGGCACCTGG + Intergenic
1057129402 9:92642590-92642612 CCAGGTGTCTACAGCGCTGATGG + Intronic
1057228301 9:93304023-93304045 CCAGCTGTCCCGTGGGCTCCTGG + Intronic
1057319038 9:93995228-93995250 GCAGATGTGCAGAGGGATCAGGG + Intergenic
1057747115 9:97761241-97761263 TCTGGAGTCCAAAGGGCTCAAGG + Intergenic
1058689790 9:107510065-107510087 CTAGGAGCCCAGAGGGCACAGGG + Intergenic
1058974153 9:110110478-110110500 CTAGGACTCCAGAGGTCTCAGGG - Intronic
1059693922 9:116713005-116713027 CCATGTGTCCAAAGGTCACATGG - Intronic
1060584093 9:124775345-124775367 CCAGGGCTCCAGGGGGCTTAGGG - Intergenic
1060711135 9:125865210-125865232 CTATATGGCCAGAGGGCTCAAGG + Intronic
1061474888 9:130858472-130858494 CCAGGTGCCCAAACGGCTGATGG - Intronic
1061618278 9:131794219-131794241 CCAGGTGCCCAGAGGTGTCCAGG - Intergenic
1061809455 9:133153951-133153973 CCAGGTCTCCCAAGGTCTCAGGG + Exonic
1062033929 9:134374397-134374419 CCAGCTGTCCTGAGGGGTGAGGG + Intronic
1062064209 9:134517615-134517637 CCACGTGGACAGAGGGATCATGG + Intergenic
1062066304 9:134528397-134528419 CAAGGAGTCCCAAGGGCTCATGG - Intergenic
1062156715 9:135053211-135053233 CAGCTTGTCCAGAGGGCTCATGG + Intergenic
1062217326 9:135396285-135396307 CCAGGTGTCCACAGGCTTCTGGG - Intergenic
1062263935 9:135678241-135678263 CCAGCAGCCCAGGGGGCTCAAGG + Intergenic
1062523229 9:136968245-136968267 GCTGGTGTGCAGGGGGCTCAGGG - Intergenic
1187139414 X:16578180-16578202 CCAGGTGACCAGGGGCTTCATGG + Intergenic
1187155250 X:16715339-16715361 CAAGTCTTCCAGAGGGCTCAGGG + Intergenic
1189653070 X:43211026-43211048 CCAGATGTCCAAGGGGGTCATGG - Intergenic
1190826699 X:54024450-54024472 AGAGGTGTCCAGAGGGAACAGGG - Intronic
1192207698 X:69107173-69107195 CCGGCTGGCCAGGGGGCTCAAGG - Intergenic
1195973636 X:110501119-110501141 CCAGGTTTCCTCAGGACTCAGGG + Intergenic
1196439524 X:115705546-115705568 ACAGGTGTACAGAGGGCTTTGGG + Intergenic
1198236295 X:134738598-134738620 CCGGGTGACCAGACAGCTCATGG + Intronic
1199721312 X:150544559-150544581 CCTGGAGTCCAGAGGGGCCAGGG - Intergenic
1200000562 X:153057697-153057719 CCAGGTGGTCAGTGGGCTCCGGG + Exonic
1200235701 X:154466821-154466843 GGCAGTGTCCAGAGGGCTCAGGG + Intronic
1201968676 Y:19767411-19767433 GGAGGTGTCCACAGGGCTTATGG - Intergenic
1202107255 Y:21384361-21384383 CCAGGTGTTAACAGGCCTCAAGG - Intronic