ID: 1019569406

View in Genome Browser
Species Human (GRCh38)
Location 7:1703757-1703779
Sequence TTTGCTTTGGACTGAAACTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 195
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 183}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019569406_1019569412 20 Left 1019569406 7:1703757-1703779 CCTGAGTTTCAGTCCAAAGCAAA 0: 1
1: 0
2: 1
3: 10
4: 183
Right 1019569412 7:1703800-1703822 CTACATCCAGTGTAACCTTGGGG No data
1019569406_1019569413 23 Left 1019569406 7:1703757-1703779 CCTGAGTTTCAGTCCAAAGCAAA 0: 1
1: 0
2: 1
3: 10
4: 183
Right 1019569413 7:1703803-1703825 CATCCAGTGTAACCTTGGGGAGG No data
1019569406_1019569411 19 Left 1019569406 7:1703757-1703779 CCTGAGTTTCAGTCCAAAGCAAA 0: 1
1: 0
2: 1
3: 10
4: 183
Right 1019569411 7:1703799-1703821 GCTACATCCAGTGTAACCTTGGG 0: 1
1: 0
2: 0
3: 8
4: 92
1019569406_1019569410 18 Left 1019569406 7:1703757-1703779 CCTGAGTTTCAGTCCAAAGCAAA 0: 1
1: 0
2: 1
3: 10
4: 183
Right 1019569410 7:1703798-1703820 AGCTACATCCAGTGTAACCTTGG 0: 1
1: 0
2: 1
3: 8
4: 110

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019569406 Original CRISPR TTTGCTTTGGACTGAAACTC AGG (reversed) Intronic
900725147 1:4211554-4211576 TTTACTTTTGACTGAGATTCAGG + Intergenic
902230431 1:15023930-15023952 GTTGCTCTGGCCTTAAACTCTGG - Intronic
902435243 1:16394377-16394399 TTTACTTTGGCCTAACACTCTGG + Intronic
904962803 1:34347911-34347933 TTTGCTTGGGTTTGAATCTCTGG + Intergenic
905089742 1:35420029-35420051 GTAGCTTTGGAGTGAAACTTTGG + Exonic
905177793 1:36148883-36148905 TTAGCTTTGGAGTTAAACACGGG + Intronic
909019134 1:70411812-70411834 TTAGATTTGGCCTGAAATTCAGG + Intronic
909926409 1:81442682-81442704 TTTGCTTTGGACTGCATCCAAGG + Intronic
910493404 1:87798411-87798433 TTCACTTTGTCCTGAAACTCAGG - Intergenic
910939065 1:92513798-92513820 TTTCCTTTGCACGGAAAATCTGG - Exonic
911832959 1:102577916-102577938 CTTGTTTTGGACTGTAAGTCGGG - Intergenic
914440660 1:147703273-147703295 TGGGCTTTGGACTGAAAATGAGG + Intergenic
916229170 1:162522243-162522265 TTTGTTTAGAACAGAAACTCAGG + Intronic
921725637 1:218520644-218520666 TTTGCTTAGAACTGATACTTTGG + Intergenic
922627294 1:227061587-227061609 TCTGCTTTGATCTGATACTCAGG + Intronic
923743065 1:236673882-236673904 TTTAATTTTGACTGGAACTCAGG - Intergenic
924312853 1:242763851-242763873 TTTGCCTTGGACTCCAACACTGG + Intergenic
924808574 1:247381313-247381335 TTTGCCTTGCAATGAAACGCAGG - Intergenic
1065786012 10:29215730-29215752 TTGGCCATGGCCTGAAACTCTGG + Intergenic
1068180424 10:53511501-53511523 ATTGCTTGGGGCTGAAACACTGG + Intergenic
1070697864 10:78576311-78576333 ATTGCTATGGACTGAAAAGCAGG - Intergenic
1072171005 10:92861601-92861623 TTGGCTCTTGACTGAAACCCTGG + Intronic
1072585077 10:96774449-96774471 TTAGCTTTGGCCTGGAACACAGG + Intergenic
1074451094 10:113560178-113560200 TTTGCTTTCACCTGAAGCTCAGG - Intronic
1075323219 10:121509152-121509174 ATTGGTTAGGAATGAAACTCTGG - Intronic
1076355502 10:129850000-129850022 TATGCTTTTGCCTGACACTCTGG - Intronic
1078132143 11:8621610-8621632 TTTGCCTTGGCCTTAAACCCTGG - Intronic
1078325983 11:10381128-10381150 GTTGCTCTTGACTGAAGCTCTGG - Intronic
1078397358 11:10992985-10993007 TTTGTTTGGGACAGAAATTCTGG + Intergenic
1079878890 11:25898214-25898236 TTTGCATTGTGCAGAAACTCAGG - Intergenic
1079878963 11:25899590-25899612 TTTGCATTGTGCAGAAACTCAGG + Intergenic
1080137498 11:28873229-28873251 TCTGATTTGGACAGAAACCCAGG - Intergenic
1080570477 11:33551878-33551900 TTTGCATTGGAGGGAATCTCTGG + Intronic
1088792904 11:113241863-113241885 TGTGGTTTGGACTCAGACTCAGG + Intronic
1089223378 11:116894500-116894522 TTTGCTCAGGATAGAAACTCTGG + Intronic
1091466712 12:691177-691199 ATTGATTTGGTCTGAAAGTCAGG - Intergenic
1093228905 12:16518809-16518831 TTTGCTTTGGACTAAGGCTCTGG - Intronic
1095691704 12:45096509-45096531 TTTCCTTTGGTCTGAAACACTGG - Intergenic
1095874262 12:47063377-47063399 ATTGCTTTGGACTGAGTTTCTGG - Intergenic
1099705751 12:86151166-86151188 TTGGCTTTTGACTGAATCTTAGG - Intronic
1099838175 12:87934204-87934226 ATTGGTTTGGACTAAAACTTAGG - Intergenic
1100708851 12:97231854-97231876 TTTCCAGTGGACAGAAACTCAGG + Intergenic
1102658579 12:114504866-114504888 TTTGCTTTGGAACAAAACTCAGG + Intergenic
1102700300 12:114833372-114833394 TATGCTTTGGACTGGAAGTTAGG + Intergenic
1103328373 12:120136845-120136867 ATTGATTTGGGCTGAATCTCAGG + Intronic
1104077681 12:125404830-125404852 TTTGCTTTGGAGTGAAACACTGG - Intronic
1104545321 12:129706941-129706963 TTTGCTTTTGACTGCATCTTTGG - Intronic
1106247789 13:27963586-27963608 GTTGCTTTGAAAAGAAACTCAGG - Intronic
1111807733 13:93058866-93058888 TTTGCTTTTGTCTGAATATCTGG - Intergenic
1113127812 13:106999830-106999852 GTTGCTTGGGTCTAAAACTCCGG + Intergenic
1118135245 14:63017810-63017832 TTTCCTTTGAACTCATACTCAGG + Intronic
1118866208 14:69705638-69705660 TTTGGTTTGGAATGGAACCCTGG + Intronic
1120226867 14:81800609-81800631 TTGGATTTGAACTGAAACACTGG - Intergenic
1123027352 14:105432957-105432979 ATCGCTTTCGACTGAAGCTCAGG - Intronic
1125372913 15:38997604-38997626 TTTGCTTTGGATTTAAGCTGAGG - Intergenic
1126238661 15:46415871-46415893 TTTGATTTGGAAGAAAACTCAGG - Intergenic
1127037431 15:54933382-54933404 TTTGCCTTGGACCTGAACTCTGG - Intergenic
1128773058 15:70297224-70297246 TTTGCTTTGGAAAGAAGCACAGG + Intergenic
1131016021 15:89058450-89058472 TGTAATTTGGACAGAAACTCTGG + Intergenic
1131793096 15:95986135-95986157 TTTTCTTCAGACTGAAACTTTGG - Intergenic
1133872681 16:9704021-9704043 GTTGGTTTGGACTGAAAGGCAGG - Intergenic
1137850802 16:51740460-51740482 TTAGCTTTGGAGTAAAACCCAGG + Intergenic
1138188019 16:54991561-54991583 TTGGATTTGAACTGAAACACTGG - Intergenic
1138327068 16:56182952-56182974 TTTGCTCTTCACTGAAAGTCTGG - Intergenic
1138451801 16:57097731-57097753 TTTGCCTAGGACTGAAAGACTGG - Intronic
1140220989 16:73043746-73043768 TTTGATATGGACAGAAACTGAGG - Intronic
1141607923 16:85165844-85165866 TTTCCTTTGGCATGAAACTGGGG + Intergenic
1144101951 17:11949255-11949277 TTGGCATTGCAATGAAACTCTGG - Intronic
1147150561 17:38511322-38511344 TTTCCTTTAGTCTGAAACTTAGG - Exonic
1148750691 17:49944252-49944274 TTTGCATTGTACTGTGACTCTGG - Intergenic
1151406298 17:73889089-73889111 TCTGCTTTGGACTGTCTCTCAGG - Intergenic
1151419854 17:73990094-73990116 TTGGCTTTGCATTAAAACTCTGG - Intergenic
1153042757 18:829272-829294 TTTGATTTGAAATGAAACTTTGG + Intergenic
1153094957 18:1390306-1390328 TTTGCTTTTGAAGGAACCTCTGG - Intergenic
1153158514 18:2176713-2176735 GTTGCATTGGATTTAAACTCAGG + Intergenic
1155866866 18:30976018-30976040 ATTGCTTTGGATTGAGACACAGG - Intergenic
1157944595 18:51965040-51965062 GTTGCCTTGGACTGAAAGGCTGG - Intergenic
1158775245 18:60570925-60570947 TCAGCTTTGAACTGAAAGTCTGG - Intergenic
1159308404 18:66676051-66676073 TTTGATTTGGATTTAGACTCTGG + Intergenic
1160215683 18:76927905-76927927 TTTGCTTTGTAATGACAATCAGG + Exonic
1160607954 18:80066325-80066347 TTTTCTGCTGACTGAAACTCAGG - Intronic
1161305940 19:3568112-3568134 TTTGCTTACAATTGAAACTCTGG + Intronic
1161855928 19:6765442-6765464 TTTGCTTTAGAATGCAACGCTGG + Intronic
1161915234 19:7223423-7223445 TCTGCTTTGGGGTGAAACGCAGG + Intronic
1162418887 19:10554425-10554447 CTGGCTTTGGCCTGAAACCCAGG - Intronic
925530871 2:4860982-4861004 TTTGCTTTGGGCCCAAATTCTGG + Intergenic
930526775 2:52540548-52540570 TTGGCTTTGACCTGAACCTCAGG - Intergenic
932533228 2:72561505-72561527 TTTCCTTTTGAGTGAAACTATGG - Intronic
934116321 2:88798950-88798972 ATTGCTTTTGACTCAAACACTGG - Intergenic
934626835 2:95865894-95865916 ATTGCTTTTGACTCAAACACTGG + Intronic
934806723 2:97235396-97235418 CTTGCTTTTGACTCAAACACTGG - Intronic
934830786 2:97521779-97521801 ATTGCTTTTGACTCAAACACTGG + Intronic
934899642 2:98148602-98148624 TTTGCTTTTGTTTTAAACTCAGG - Intronic
935404749 2:102697285-102697307 TTGGGTTTGGCCTGGAACTCAGG + Intronic
940064964 2:149617189-149617211 TTTCTTTTGGTCTGAAACTCTGG + Intergenic
940082099 2:149814667-149814689 TTTGCTTTGGATTTATACTTTGG + Intergenic
942142220 2:172988833-172988855 TTTGCTTTGGACTCACCCTTAGG - Exonic
942235517 2:173900297-173900319 TGTGTTTTGGAGTGATACTCTGG + Intergenic
943056904 2:182993315-182993337 TTGGCTGTTGACTGAATCTCTGG + Intronic
943415283 2:187593844-187593866 TATGCTGTGGTCTGAAGCTCTGG - Intergenic
944616844 2:201469358-201469380 TGTGCTTTGGAGTGAGAGTCAGG - Intronic
945351288 2:208784227-208784249 TTTGATGTGGATTGAAACTCAGG + Intronic
949055710 2:241927312-241927334 TTTCCTTTAGACTGAAAGTGGGG + Intergenic
1168890385 20:1292152-1292174 TATGCCTTAGACTAAAACTCAGG - Intronic
1170655700 20:18286073-18286095 CCTGCTTTTGACTGTAACTCTGG + Intergenic
1174951502 20:55046330-55046352 TTTGGTTTGGTCTGAATATCTGG - Intergenic
1179661916 21:42881673-42881695 TTAGCTTTGGACTAGAAGTCTGG - Intronic
1180133966 21:45848739-45848761 TTTGCTTTGGACTGCAGCGCTGG + Intronic
1182007537 22:26973501-26973523 TTGGGGTGGGACTGAAACTCAGG + Intergenic
949601451 3:5602741-5602763 TTTGCTGTGGTCTGAAAGTGTGG - Intergenic
952731059 3:36636896-36636918 TTTGCTGAGGACTGAAAAACTGG - Intergenic
955565411 3:60239220-60239242 TCTGCTTTGGTCTGAAAATTTGG + Intronic
956044087 3:65176575-65176597 TTGGGTTGGGACTGAAACTCCGG - Intergenic
957014042 3:75043062-75043084 TTTGTTTGGTAGTGAAACTCAGG + Intergenic
959644996 3:108689356-108689378 TTTGCTTTTGAAAGATACTCAGG + Intronic
959944632 3:112113860-112113882 ATTGCTTTGTAGTGAAGCTCTGG + Intronic
960021330 3:112957045-112957067 TTTGCCTTGGACCCCAACTCTGG - Intronic
960533535 3:118792341-118792363 TTTGCTTTGTAATGAATCTTAGG + Intergenic
963091103 3:141484926-141484948 CATGCTTTTGACTGGAACTCTGG - Intergenic
966405268 3:179591076-179591098 TTTGTTTTGGTATGAAAATCGGG + Intronic
966519273 3:180855300-180855322 TTTTATTTGAACTGAAAGTCAGG + Intronic
971103974 4:23501036-23501058 CTTGCTTTGGAATGGAACTCTGG + Intergenic
971340777 4:25766746-25766768 TCTGCTTTGGACTGTGTCTCTGG - Intronic
973005834 4:45005866-45005888 TTTTCTTTGAAATGAAAATCTGG - Intergenic
973901251 4:55474500-55474522 TTTCATCTGCACTGAAACTCTGG - Intronic
977936156 4:102807127-102807149 TTTGCTTTGGACTACTACTTAGG - Intronic
981160459 4:141492021-141492043 TTTGCTCTGGACTAACATTCTGG - Intergenic
982443816 4:155466852-155466874 TTTGCCTTGAACTAAACCTCAGG + Intergenic
984018280 4:174452319-174452341 ATTACTTGGTACTGAAACTCTGG + Intergenic
984173569 4:176389423-176389445 TTTCCTGTGGGCTGAGACTCTGG - Intergenic
984419262 4:179498409-179498431 TGTGCTTTGGACTCAAATTTTGG + Intergenic
986002885 5:3643867-3643889 TTTGCTTTGCACTAAAACATAGG + Intergenic
987140301 5:14938998-14939020 TTTCCTTTCCACTGAAAATCTGG - Intergenic
987839205 5:23200722-23200744 TTTTCTTTGTACTGAAAAACAGG - Intergenic
988536021 5:32069547-32069569 TTTGCTTTCTGCTGAAAATCAGG + Exonic
988579593 5:32457545-32457567 ATGGCTTTGGACTGGAAATCAGG - Intergenic
988900421 5:35726369-35726391 TTTCCTTTGACCTGAATCTCTGG - Intronic
988920634 5:35938566-35938588 GTTGCTTCGAACTGAAACTATGG + Intronic
989148510 5:38273220-38273242 TTTGCTTTGCACTCTAATTCTGG + Intronic
990365171 5:55063235-55063257 GTTGCTTTGGGCTAAAACCCTGG + Intergenic
991573049 5:68075590-68075612 TTGGCCTAGTACTGAAACTCAGG - Intergenic
994146262 5:96399246-96399268 TTTGCTGTGGAGTCAAATTCAGG + Intronic
995641775 5:114265513-114265535 TTTGATTCTGACTGAAACACTGG - Intergenic
996038814 5:118787813-118787835 TTTGCTTTGAACTAAAAATGTGG + Intergenic
996995828 5:129695767-129695789 TTTACTTTGTCCTGACACTCAGG + Intronic
997909151 5:137852082-137852104 TTTGCTTTAGACTAAAACTTAGG - Intergenic
999095152 5:148971262-148971284 TGTGCTCTGTACTGAAACTGGGG + Intronic
999630810 5:153569397-153569419 TTTTATTTGGCCTGAAATTCTGG - Intronic
1001532469 5:172473316-172473338 TTTGCTTTCAACTTAAACTGTGG - Intergenic
1001786851 5:174421080-174421102 TATGCTTTGGACTCCATCTCTGG - Intergenic
1001829785 5:174776248-174776270 CTCGCATGGGACTGAAACTCTGG - Intergenic
1004459807 6:15825375-15825397 TCTGTTTTGGAGGGAAACTCAGG - Intergenic
1004631460 6:17425616-17425638 TTTTGTTTGGTCTGTAACTCTGG + Intronic
1009292562 6:61902349-61902371 TTTGACTTTGACTGAATCTCTGG - Intronic
1009435416 6:63612753-63612775 TTTGTTTACAACTGAAACTCTGG + Intergenic
1009868716 6:69430166-69430188 TTTGCATATGACTGAAACCCAGG + Intergenic
1010375173 6:75160356-75160378 ATTGCTTTCACCTGAAACTCAGG - Intronic
1014678194 6:124394624-124394646 TTGGGTTTGGACTGAAATACTGG - Intronic
1014694088 6:124596928-124596950 CTGCCTTTGGACTTAAACTCAGG - Intronic
1015470769 6:133603587-133603609 TTGCCTTTGAACTGAAACACTGG - Intergenic
1015701346 6:136038798-136038820 CTTGGTGGGGACTGAAACTCAGG - Intronic
1018017503 6:159725880-159725902 GTTGCTTTGGAATGAGTCTCAGG - Exonic
1019569406 7:1703757-1703779 TTTGCTTTGGACTGAAACTCAGG - Intronic
1019800118 7:3082190-3082212 TTTCCTTTGGACTTAATTTCAGG - Intergenic
1023648509 7:42344244-42344266 TTTGGTTTGCCCTGTAACTCTGG - Intergenic
1032310144 7:130778714-130778736 TTTGCTGTGGTCTGAGAGTCTGG + Intergenic
1033246084 7:139717354-139717376 GTTGCTTTCTACTGAAACTCAGG + Intronic
1037709471 8:21344023-21344045 TTTGCTCTGGTCTGAAGCACGGG - Intergenic
1037912741 8:22753756-22753778 TTGGCTTTGGGATGAATCTCAGG + Intronic
1039089327 8:33811839-33811861 TAGGCTCTGGACTGAAACCCAGG - Intergenic
1039296093 8:36156702-36156724 TTTCCTCTTCACTGAAACTCTGG - Intergenic
1039740733 8:40380347-40380369 TCTGCTTTGGGCTGCATCTCTGG - Intergenic
1040071519 8:43192447-43192469 TTCGCTTAGAACTGGAACTCAGG + Intronic
1041334931 8:56771526-56771548 TTCTCTGTGGACTGAAGCTCTGG - Intergenic
1041444502 8:57935147-57935169 TTCGCTTTTGACTGAATATCTGG + Intergenic
1041884380 8:62791335-62791357 TTTGCTCTGGACAGAAAATGTGG - Intronic
1042239981 8:66654134-66654156 TAAGCTTTGGACTGATACACAGG - Intronic
1045130044 8:99140737-99140759 TTTGTTTACAACTGAAACTCTGG + Intronic
1046665089 8:116992744-116992766 CTTGCATTGGACTTAAACTATGG + Intronic
1046895336 8:119465391-119465413 TTTGGTTGGGAATGAAATTCTGG - Intergenic
1047144745 8:122185823-122185845 AGTGCTTTGCACTGAATCTCTGG - Intergenic
1047849728 8:128843506-128843528 TTTGCTTTGGCCTATAACACTGG + Intergenic
1048930641 8:139312970-139312992 TTTGCTATGGACTATCACTCAGG - Intergenic
1050678116 9:8079304-8079326 TTTGCTTTAGGCTGAAAGTTGGG - Intergenic
1056150966 9:83787877-83787899 TTTGATTTGTAGTGCAACTCTGG + Intronic
1056713722 9:89011731-89011753 TCTGCAGTGGATTGAAACTCTGG - Intergenic
1057044199 9:91872233-91872255 TTTCCTTTTGACATAAACTCAGG - Intronic
1058182302 9:101813656-101813678 TTTTCTGTGTACTGTAACTCTGG + Intergenic
1059140069 9:111844634-111844656 TTCAGTTTGCACTGAAACTCAGG - Intergenic
1061346804 9:130032921-130032943 GTTGCTTTGGACAGGAAATCTGG - Intronic
1188645252 X:32558626-32558648 TTTGCTTTTATGTGAAACTCTGG - Intronic
1190639635 X:52471452-52471474 ATTCCTGTGGACTGTAACTCCGG + Intergenic
1191679756 X:63829099-63829121 TTTGCCTTAGACTGGAACACTGG - Intergenic
1192875584 X:75226087-75226109 GTTGCTTTGGACAGAAACCTTGG + Intergenic
1199435596 X:147809133-147809155 TTTGCTTTTTACTGAAAATTGGG - Intergenic