ID: 1019572679

View in Genome Browser
Species Human (GRCh38)
Location 7:1720260-1720282
Sequence CTCCAGTGGGAAGACGAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 204}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019572667_1019572679 25 Left 1019572667 7:1720212-1720234 CCTTGCACTCAGGCCCAGGCTGG 0: 1
1: 1
2: 6
3: 125
4: 1779
Right 1019572679 7:1720260-1720282 CTCCAGTGGGAAGACGAAGATGG 0: 1
1: 0
2: 1
3: 22
4: 204
1019572670_1019572679 12 Left 1019572670 7:1720225-1720247 CCCAGGCTGGATGGAGTCCACGG 0: 1
1: 0
2: 18
3: 608
4: 619
Right 1019572679 7:1720260-1720282 CTCCAGTGGGAAGACGAAGATGG 0: 1
1: 0
2: 1
3: 22
4: 204
1019572672_1019572679 11 Left 1019572672 7:1720226-1720248 CCAGGCTGGATGGAGTCCACGGC 0: 1
1: 0
2: 1
3: 36
4: 796
Right 1019572679 7:1720260-1720282 CTCCAGTGGGAAGACGAAGATGG 0: 1
1: 0
2: 1
3: 22
4: 204
1019572673_1019572679 -5 Left 1019572673 7:1720242-1720264 CCACGGCCTCTGCCCTTACTCCA 0: 1
1: 0
2: 2
3: 26
4: 370
Right 1019572679 7:1720260-1720282 CTCCAGTGGGAAGACGAAGATGG 0: 1
1: 0
2: 1
3: 22
4: 204

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019572679 Original CRISPR CTCCAGTGGGAAGACGAAGA TGG Intronic
900501734 1:3009162-3009184 CTCCTGTGGGATGACGGAGCTGG + Intergenic
900719230 1:4164562-4164584 CACCTGTGGGAGGAGGAAGATGG - Intergenic
900884287 1:5404241-5404263 CTCCAGAGGGGAGAGGAAGCAGG - Intergenic
901727155 1:11250801-11250823 CTGCAGTGGGAAGACTGAAATGG - Intronic
901817041 1:11800289-11800311 GACCAGTGGGAAGAGGAGGAGGG - Exonic
902292164 1:15442487-15442509 CTGGAGGTGGAAGACGAAGAAGG + Exonic
906289874 1:44612900-44612922 AACCAGTGGGAAGAAGAAGAAGG + Intronic
908315413 1:62927689-62927711 CCCAAGTGGGAAGACGAAAGTGG + Intergenic
910034918 1:82777912-82777934 CTCAAGTGGGAAGAAGCAGAGGG - Intergenic
910359035 1:86396188-86396210 CTACAGTGGGTAGACTAGGAAGG + Exonic
912548859 1:110471359-110471381 CTAAAATGGGATGACGAAGATGG - Intergenic
914329094 1:146649394-146649416 CTCCAAGAGGAAGAGGAAGAGGG + Intergenic
915223958 1:154397882-154397904 TTCCAGGGAGAAGAGGAAGAAGG - Intergenic
916247340 1:162701979-162702001 CTCCAGTGGGAAGAGAAAAGTGG - Intronic
919662262 1:200258767-200258789 CTCCCGTGGGAAGCCTAACATGG + Intergenic
920309451 1:205040199-205040221 CTACAGTAGGAAGAAGCAGATGG + Intergenic
920791237 1:209094939-209094961 CAGCAGTGGGAAGAAAAAGAAGG + Intergenic
922875305 1:228935796-228935818 CTGCAGTGGGAAGAGGCAGCCGG - Intergenic
924185515 1:241485152-241485174 ATCCAGTGAGAAGCTGAAGATGG - Intergenic
1063131521 10:3181954-3181976 CTGAAGTGGGAAGAGGAAGGAGG + Intergenic
1063149561 10:3323942-3323964 CTCAAGTGGGAAGAACAACAGGG - Intergenic
1063515036 10:6687429-6687451 GTACAGTGGGAGGAAGAAGAGGG - Intergenic
1064699077 10:18000136-18000158 CTGCAGTGGGAAGTGGCAGAAGG + Intronic
1064748159 10:18498332-18498354 CTAAAGTGGGAAAAGGAAGAGGG - Intronic
1066332956 10:34444846-34444868 TTCCAGTGGGAATAAGCAGAAGG - Intronic
1067524429 10:47029550-47029572 CTCCAGGGGGAAGACAGAGCAGG + Intergenic
1068994100 10:63182742-63182764 CTCCAGTAAAAAGAGGAAGAAGG - Intronic
1071016099 10:80998655-80998677 CTGCAGTGGGATGAAGGAGAGGG + Intergenic
1072704810 10:97673558-97673580 CTGCAGTGGGAAAAAGGAGATGG - Intronic
1073348039 10:102799357-102799379 AACCAGTGGCAAGACAAAGATGG - Intronic
1073758678 10:106607781-106607803 CTCCAGTGGGCTGACGAAGGAGG - Intronic
1076812790 10:132897994-132898016 CTCCAGTGGGAGGAGGAGGACGG - Intronic
1076884864 10:133257669-133257691 CTCCAGTGGGAAGGAGAGCAAGG - Intergenic
1077877757 11:6321885-6321907 GTTCAGTGAGAAGAGGAAGAGGG - Intergenic
1081542101 11:44042750-44042772 TTCCAGTGGAAAGACCAGGATGG - Intergenic
1084945148 11:72634312-72634334 GGCCTGTGGGAAGAGGAAGACGG + Intronic
1087061852 11:93986693-93986715 CTCCAGTAGAAAGACCCAGAAGG + Intergenic
1087322746 11:96683392-96683414 CACAAATGGGAAGAGGAAGATGG - Intergenic
1087661898 11:100998157-100998179 CTCCAGAAGAAAGATGAAGATGG + Intergenic
1090998944 11:131892180-131892202 CTTAAATGGGAAGAAGAAGAAGG - Intronic
1091555063 12:1566811-1566833 CTGCAGTGGGAAGAAGAAAAAGG + Intronic
1092858317 12:12695843-12695865 ATACAGTGGGAAGGAGAAGATGG - Intronic
1096848131 12:54419004-54419026 CTCCACTGAGAATCCGAAGAAGG + Exonic
1097612309 12:61839225-61839247 TTTCAGTGGGCAGACAAAGAAGG + Intronic
1098453602 12:70648025-70648047 CTGCAGTGGGAAGCCTAAGTGGG - Intronic
1099018255 12:77371446-77371468 TACCAGTGGGAAGAGGGAGAGGG + Intergenic
1100445303 12:94654532-94654554 CTCTGGTGGGGAGATGAAGAAGG + Intergenic
1100699779 12:97134912-97134934 CTCCTGTGGGAAAACAGAGATGG + Intergenic
1100922753 12:99507599-99507621 CTCCATTAGGAAGCAGAAGAGGG - Intronic
1106396820 13:29388260-29388282 CACCAGTGGGAAAATAAAGATGG + Intronic
1108027178 13:46190226-46190248 CTCCAGTGAGAAGAATAAGATGG + Intronic
1108106425 13:47015409-47015431 CTCGGGAGGGAAGAGGAAGAAGG + Intergenic
1113123415 13:106949244-106949266 CTCCCGTGTGAAGCTGAAGATGG - Intergenic
1113728138 13:112620500-112620522 CTGCAGTGGAAAGACGTACATGG - Intergenic
1115081708 14:29460968-29460990 TTCCAGTGGAAAGAAAAAGATGG - Intergenic
1115619040 14:35122714-35122736 CTCCGGTGGGGGGACGAGGAGGG - Intronic
1116590751 14:46769407-46769429 ATCAAGTGGGAAGAGAAAGAAGG - Intergenic
1117935845 14:60906135-60906157 CACCAGTGGGAATATGAATAAGG + Intronic
1119031934 14:71199617-71199639 CTCCAAAGGGAAGAGGATGATGG + Intergenic
1120384218 14:83823719-83823741 CTCTGGTGAGAAGAGGAAGAGGG - Intergenic
1120926650 14:89803805-89803827 CGCCAGTGGGAAGAAGCAGCGGG - Intronic
1121392787 14:93590329-93590351 CTGCAGTGGGAGGAAGAAGCTGG + Intronic
1121881123 14:97501072-97501094 CACAAGTGGGAAGGTGAAGATGG - Intergenic
1122635201 14:103126598-103126620 CACCAAAGGGAAGAAGAAGAAGG + Exonic
1123130883 14:105984378-105984400 CTCCAGTGGGAAGGAGATGAAGG - Intergenic
1123581114 15:21715599-21715621 CTCCAGTGGGAAGGAGATGAAGG - Intergenic
1123617763 15:22158222-22158244 CTCCAGTGGGAAGGAGATGAAGG - Intergenic
1124889203 15:33716383-33716405 GTCCAGTGGGAGAACGAAGAAGG - Intronic
1127611961 15:60645753-60645775 CTGCAGTGGGAAGAAGAGGATGG - Intronic
1128558096 15:68645335-68645357 CTCCAGGGGGATGACGAGGAAGG - Exonic
1128965556 15:72053985-72054007 CTCCAGTTAAAAGACAAAGATGG + Intronic
1129974515 15:79811145-79811167 CTCAAATGAGAAGATGAAGAGGG - Intergenic
1130272708 15:82460447-82460469 CCCCAGTGGGAAGAGGACTAGGG + Intergenic
1130465060 15:84187801-84187823 CCCCAGTGGGAAGAGGACTAGGG + Intergenic
1130487628 15:84407003-84407025 CCCCAGTGGGAAGAGGACTAGGG - Intergenic
1130499205 15:84485736-84485758 CCCCAGTGGGAAGAGGACTAGGG - Intergenic
1130587350 15:85192414-85192436 CCCCAGTGGGAAGAGGACTAGGG + Intergenic
1131208235 15:90470241-90470263 CTCCAGAGAGAAAATGAAGAAGG - Intronic
1133241569 16:4417047-4417069 CACCAGTGGTAAGAGGCAGAGGG + Intronic
1134029050 16:10977365-10977387 CTCCAGTGAGTACACGTAGAGGG - Exonic
1135495814 16:22950223-22950245 CTCCAGTGAGAAGGAGAAGCTGG - Intergenic
1135869471 16:26136216-26136238 TTTCAGTGGGAACAGGAAGAGGG + Exonic
1138459773 16:57141282-57141304 CCCCAGAGGGAAGAAGCAGAAGG + Intronic
1139665061 16:68449210-68449232 CTGCGATGGGAAGACGGAGACGG - Intergenic
1141404986 16:83784803-83784825 TTGCAGTGGGAAGACCAGGAAGG - Intronic
1142115775 16:88355430-88355452 GTCCAGCGGGAAGATGAACATGG - Intergenic
1142176342 16:88647120-88647142 CCCCCGGGGGAAGAGGAAGAAGG - Exonic
1143937497 17:10502144-10502166 TTCCAGTGGGGAGATGCAGAAGG - Intronic
1145981748 17:29016775-29016797 CTCCAGTGAGTAGAGGAAGCTGG - Intronic
1146911797 17:36653163-36653185 CCTCAGTGGGAGGAAGAAGAGGG - Intergenic
1148443240 17:47722500-47722522 CTCCAGAGGGAATAAGGAGAAGG + Intergenic
1148977529 17:51542741-51542763 CAGCAGGGGGAAGAGGAAGAGGG + Intergenic
1150012351 17:61516638-61516660 CTACAGTGAGAAGAGGCAGATGG + Intergenic
1150061887 17:62075641-62075663 CTCCACTAGGAAGAAGAAGGGGG + Intergenic
1150295295 17:64004089-64004111 CTCCAGTGCAGAGAGGAAGAGGG + Intronic
1151355498 17:73555644-73555666 CTCAACTGGGAAGATGAGGAAGG + Intronic
1152060245 17:78067816-78067838 AGCCAGTGGGAGGATGAAGAAGG + Exonic
1152676679 17:81644969-81644991 CTGCAGAGGGAAGAGGAACAGGG - Intronic
1155215335 18:23638492-23638514 CTTCAGTGGGAAAAAGAACATGG + Intronic
1156347358 18:36269748-36269770 ATCCAGGGGGAAGATGATGAAGG - Exonic
1160947688 19:1651347-1651369 CTCCAGTTGGCAGACAAAGAGGG - Intronic
1161881432 19:6956695-6956717 CTCCAGAGGAAAGACGATGTGGG + Intergenic
1163377759 19:16944187-16944209 CTCCGGTGGGAAGAGGTAGGAGG + Intronic
1163741823 19:19018974-19018996 CTCCAGTGAGAAGAGCATGAGGG - Intronic
1164975553 19:32570479-32570501 CTGAAGTGGGAAGAGAAAGATGG + Intergenic
1167261618 19:48462131-48462153 CTCCAGCGCGAAGAGGAAGGCGG - Exonic
1167358828 19:49019308-49019330 CTCCAGTGGCCACACCAAGACGG - Intergenic
1167366526 19:49057555-49057577 CTCCAGTGGCCACACCAAGAAGG - Exonic
1167990139 19:53352883-53352905 CTCCAGTATGAAGTCTAAGATGG - Exonic
1168002060 19:53455536-53455558 CTCCAGTATGAAGTCGATGATGG - Exonic
1168618728 19:57859519-57859541 CTCCAGTGTGAACACGCTGATGG - Exonic
1168624779 19:57909149-57909171 CTCCAGTGTGAACACGCTGATGG + Exonic
1168624796 19:57909317-57909339 CTCCAGTGTGAACACGCTGATGG + Exonic
928281745 2:29952560-29952582 TTCCAGCGGAAAGAAGAAGATGG + Intergenic
931518285 2:63066959-63066981 TCCCAGTGGGAAGAGGTAGAAGG - Intergenic
932470533 2:71952251-71952273 TTCCAGTGGGAACACCAGGAGGG + Intergenic
936972426 2:118188035-118188057 ACACAGGGGGAAGACGAAGAGGG + Intergenic
938937429 2:136139336-136139358 TTCCAGTGAGAAGAGGAGGAAGG - Intergenic
940260775 2:151777382-151777404 CACCAGTGGGAAGACACAGCAGG - Intergenic
942821774 2:180123227-180123249 CTCCAGTGGGAAGAGGTTAATGG + Intergenic
942894863 2:181040259-181040281 GTCCCGTGGAAGGACGAAGAAGG - Intronic
943641241 2:190360646-190360668 CTCCAGTGGTGGGACTAAGAGGG - Intronic
944877100 2:203973345-203973367 CCCCAGTGTGTAGAGGAAGATGG - Intergenic
946417702 2:219548855-219548877 GTCCAGTGGAAAGATGATGATGG + Intronic
947036736 2:225867162-225867184 CTGCAGTGGGAAGATCAAAATGG + Intergenic
948129765 2:235591907-235591929 ATCATGTGGGAAGACGAAGGGGG - Intronic
1174290572 20:49505700-49505722 CTCCAGTGGGAGGACAGAGCCGG - Exonic
1177398601 21:20571030-20571052 CACCACTGGGAAGGAGAAGAAGG - Intergenic
1180202048 21:46229757-46229779 CAGCAGAGGGAAGAGGAAGATGG + Intergenic
1180225013 21:46387035-46387057 CTCGAGTGGGGACACAAAGACGG - Intronic
1181685675 22:24526153-24526175 CACCAGTGGGAAGAGGGTGAGGG + Exonic
1182416235 22:30223160-30223182 GTCCAGTGGGAAGACGGACATGG - Intergenic
1182711998 22:32328992-32329014 CACCAGTAGGAAGAGGAAGCAGG - Intergenic
1184117194 22:42429050-42429072 CTCAAGTGGGAGGAGGAGGATGG + Intronic
1184164073 22:42717158-42717180 GTCCAGAGGGAAGACAAAGGTGG + Intronic
1184399542 22:44265876-44265898 CACCAGTAGGAAGAGGAAGCAGG - Intronic
1184935184 22:47716005-47716027 CTGCAGTGGGAAGAGGATGCAGG + Intergenic
953384363 3:42498059-42498081 CTCCAGGGGATAGAGGAAGAGGG - Intronic
953787035 3:45918980-45919002 CTTCAGTGGCATGATGAAGAAGG + Exonic
957243310 3:77686721-77686743 CTCCTGTGGGAAAAGGAGGAAGG + Intergenic
959160835 3:102722632-102722654 ATCCACTGGGAAGATGATGAGGG - Intergenic
961384993 3:126518220-126518242 CTCCAGTGGGGAGCCAAGGAGGG - Intergenic
962425370 3:135264879-135264901 CTCCAATGGGAAAATGAAGAGGG + Intergenic
963753759 3:149211776-149211798 ATCCAGAGGGAAGAGAAAGAAGG - Intronic
964621272 3:158722111-158722133 ATCCAGAAGGAACACGAAGAAGG + Intronic
965771407 3:172185301-172185323 GTACAGTGGGAAGAAGATGAGGG - Intronic
967750448 3:193108930-193108952 ATCAAGAGGGAAGATGAAGAAGG - Intergenic
968441335 4:626009-626031 GTCCAGTGGGAAGACGATCTCGG - Exonic
971294001 4:25373113-25373135 CTCCAGTGGAGAGACCAACAGGG - Intergenic
975201171 4:71591600-71591622 CTCTTGTGGGAAGAAGTAGAAGG - Intergenic
978752476 4:112266695-112266717 CTAGAGTGGGAAGATGAAGAAGG + Exonic
980955086 4:139419765-139419787 TTCCTCTGGGAAGAGGAAGAAGG + Intronic
981934752 4:150227778-150227800 ATACAGTAGGAAGACAAAGAAGG - Intronic
982070662 4:151691693-151691715 CTCCAGTTGGAATAGGATGAAGG + Intronic
982657908 4:158171490-158171512 CTCCAGTGGGCAGAGGTGGAAGG + Exonic
984513823 4:180713431-180713453 CTTCAATGGGAAGAGGAAAAGGG + Intergenic
985519161 5:363195-363217 CTCCAGTGGGAGGAACAAGAGGG + Intronic
986142918 5:5048688-5048710 GTCCATTGGGAATAGGAAGAAGG - Intergenic
988083350 5:26441305-26441327 GTCTAGTGGGAAGACAAACATGG + Intergenic
988977379 5:36528554-36528576 ATCCAGAGTGAAGAGGAAGACGG - Intergenic
989237776 5:39169541-39169563 CTCCAGTTGAAAGACCAAGGAGG + Intronic
991524960 5:67546284-67546306 CTGCTGGGGGAAGATGAAGAAGG - Intergenic
991578647 5:68131271-68131293 GTCCAGTGGGAATATGAAGCAGG - Intergenic
992347277 5:75892581-75892603 CTACAGAGGGAAGATGAGGAAGG - Intergenic
994518302 5:100797375-100797397 CTGCAGTGGGAAGGCATAGATGG - Intergenic
997528534 5:134568552-134568574 CTCCTCTGGGAAGAGGAAGCAGG + Intronic
998333840 5:141352652-141352674 CTCACGTGCGAAGACAAAGAAGG - Exonic
1002549297 5:179975088-179975110 GTCCCGTGGGAAGACGGTGAGGG + Intronic
1004981993 6:21034384-21034406 CTCCAGTGATAAGACAAAGATGG - Intronic
1005824426 6:29624215-29624237 CTCCAGATGGAAGACAGAGAAGG - Intronic
1005906333 6:30264090-30264112 TTCCAGTGGGAAGAGGCAGACGG + Intergenic
1013284818 6:108672123-108672145 CGGCATTGGGAAGACAAAGATGG - Intronic
1013746948 6:113357179-113357201 CTCTTGTGGGAAAACGCAGAAGG + Intergenic
1014393865 6:120899407-120899429 CTCCAGTGTGGAGATCAAGAAGG + Intergenic
1016486425 6:144544713-144544735 CTCTGGTGGGAAAACGAAAAAGG - Intronic
1016812259 6:148272894-148272916 TTCCACAGAGAAGACGAAGACGG - Intronic
1017875234 6:158518610-158518632 TTTCAGTGTGAACACGAAGAAGG - Intergenic
1018279767 6:162172893-162172915 CTCCAGAAGAAAGAGGAAGAAGG + Intronic
1018700748 6:166424126-166424148 ATCCAGTGGGAGGATGTAGAAGG + Intronic
1019572679 7:1720260-1720282 CTCCAGTGGGAAGACGAAGATGG + Intronic
1019632005 7:2054364-2054386 CTCCAGTGTGAAGATGATGAAGG - Intronic
1020033731 7:4951237-4951259 CTCCAGTGGGAAGAAAATAAAGG - Intronic
1020265100 7:6555258-6555280 CTCCAGTGGAAAGGTGAAGATGG + Intergenic
1021009454 7:15443334-15443356 CTCTAGGGGGAACATGAAGATGG - Intronic
1022385597 7:29896045-29896067 TTCCAGAGAGAAGAGGAAGAAGG + Intronic
1023590389 7:41775073-41775095 CCCCAGTGAGAAGGCGCAGAGGG + Intergenic
1028287968 7:89027683-89027705 CTTCAATGTGAAAACGAAGAAGG + Intronic
1029054958 7:97732325-97732347 CTGCAGGTGGAAGACAAAGAGGG - Intronic
1032043552 7:128582791-128582813 CTGCAGTGGCATGAAGAAGAGGG - Intergenic
1032970244 7:137153621-137153643 CTACAGTTGGAAGAAGAAGTGGG - Intergenic
1033075554 7:138247035-138247057 CTCCAGGGGGAAGGAGGAGATGG - Intergenic
1033268635 7:139910867-139910889 ATCCAGTAGTAAGACAAAGAAGG - Intronic
1034165517 7:149022203-149022225 CTCAAGTGTGAAGGGGAAGAGGG + Intronic
1034281888 7:149860375-149860397 CTCCAAAGGGAACAAGAAGATGG + Exonic
1036098320 8:5749803-5749825 TCCCAGTGGGTAGAGGAAGATGG + Intergenic
1036288144 8:7462652-7462674 ATCCACTGGGGAGACGTAGAGGG - Intronic
1036333331 8:7848876-7848898 ATCCACTGGGGAGACGTAGAGGG + Intronic
1036685386 8:10905907-10905929 CTCCTGTGGGAAGGCGAGGACGG - Intronic
1037401362 8:18498124-18498146 ATGCAGTGGGAAGACTTAGAAGG + Intergenic
1038042647 8:23738010-23738032 CTCAAGGAGGAAGAAGAAGAAGG - Intergenic
1038605088 8:28993555-28993577 CTCCAGTGGAATGAAGAAGGGGG + Intronic
1042054842 8:64753855-64753877 CTCCAGTCAGAAGAGGAAGGGGG + Intronic
1044729616 8:95219468-95219490 CTCCAGTGAGAAGGAGGAGAGGG - Intergenic
1044840889 8:96336282-96336304 CTTCTGAGGGAAGACCAAGAAGG - Exonic
1045663056 8:104457994-104458016 GTCCAGTGGGAAGACGAAGGTGG - Intronic
1046803543 8:118455093-118455115 GTCCAGTGGGAGGATGAGGAAGG - Intronic
1046955039 8:120054032-120054054 GTCCAGTGAAAAGACGAAGCGGG - Intergenic
1047432989 8:124808779-124808801 AACCAGTAGGAAGACAAAGAAGG - Intergenic
1048292817 8:133193358-133193380 CTGCAGTGGAAGGAGGAAGATGG + Intronic
1050264932 9:3879999-3880021 CAGCAGTGAGAAGAGGAAGAAGG - Intronic
1051142520 9:13993134-13993156 CTACAGTGGGAAGACAAAAGGGG - Intergenic
1055286352 9:74732322-74732344 CTCCATTGTGAAGACAAAAAAGG + Intronic
1057280523 9:93708083-93708105 CTGCAGGGGGAAGAAGGAGATGG + Intergenic
1061916171 9:133755629-133755651 CACCAGTGGGGAGAGGGAGAGGG + Intergenic
1062699522 9:137891625-137891647 CTCCAGTGTGAAGGAGGAGAAGG - Intronic
1185872494 X:3675576-3675598 CCCCAGTGGGAGGAAGAGGAGGG - Intronic
1185989428 X:4876459-4876481 ATTCAGTGGAAAGAGGAAGAGGG + Intergenic
1188918011 X:35935638-35935660 TTCAAGTGGGCAGAGGAAGAAGG - Intronic
1190384176 X:49868448-49868470 CTCCAGTGGGTAAAAGAGGAGGG + Intergenic
1190797104 X:53756016-53756038 CTCGAGTGGGAAAATGAGGAAGG + Intergenic
1191002963 X:55681028-55681050 CCCCAGTGAAAAGACGCAGATGG - Intergenic
1195697398 X:107677032-107677054 TTCCAGTGGGATGAGGAGGACGG + Intergenic
1195756561 X:108204616-108204638 CTGCAGAGGGAAGAGCAAGATGG + Intronic
1198683961 X:139208261-139208283 CTACAGTGGGATGAGGGAGATGG - Intronic
1200791421 Y:7303126-7303148 CCCCAGTGGGAGGAAGAGGAGGG + Intergenic
1201897148 Y:19004026-19004048 CTTCAGCAGGAAGACAAAGAGGG + Intergenic
1202370178 Y:24190893-24190915 CCCCAGTGGGAAGAGGACTAGGG - Intergenic
1202500606 Y:25479224-25479246 CCCCAGTGGGAAGAGGACTAGGG + Intergenic