ID: 1019572688

View in Genome Browser
Species Human (GRCh38)
Location 7:1720300-1720322
Sequence ACGTCTCCACAGTGGGCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 123}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019572677_1019572688 23 Left 1019572677 7:1720254-1720276 CCCTTACTCCAGTGGGAAGACGA 0: 1
1: 0
2: 0
3: 5
4: 95
Right 1019572688 7:1720300-1720322 ACGTCTCCACAGTGGGCCCCAGG 0: 1
1: 0
2: 0
3: 9
4: 123
1019572676_1019572688 29 Left 1019572676 7:1720248-1720270 CCTCTGCCCTTACTCCAGTGGGA 0: 1
1: 0
2: 0
3: 18
4: 176
Right 1019572688 7:1720300-1720322 ACGTCTCCACAGTGGGCCCCAGG 0: 1
1: 0
2: 0
3: 9
4: 123
1019572678_1019572688 22 Left 1019572678 7:1720255-1720277 CCTTACTCCAGTGGGAAGACGAA 0: 1
1: 0
2: 1
3: 11
4: 97
Right 1019572688 7:1720300-1720322 ACGTCTCCACAGTGGGCCCCAGG 0: 1
1: 0
2: 0
3: 9
4: 123
1019572681_1019572688 15 Left 1019572681 7:1720262-1720284 CCAGTGGGAAGACGAAGATGGGA 0: 1
1: 0
2: 1
3: 20
4: 173
Right 1019572688 7:1720300-1720322 ACGTCTCCACAGTGGGCCCCAGG 0: 1
1: 0
2: 0
3: 9
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019572688 Original CRISPR ACGTCTCCACAGTGGGCCCC AGG Intronic
900863384 1:5249575-5249597 ACTTCTACACATTGGGACCCAGG + Intergenic
902640201 1:17762179-17762201 TCGTCTCCACCCTGGGTCCCGGG - Intronic
903005518 1:20295648-20295670 CTGTCTCCACAGTGGCACCCAGG - Intronic
917483187 1:175431075-175431097 ACGGCTCCACACAGGGCCCAGGG + Intronic
920351055 1:205338309-205338331 ACCTATCCACTGTGGGCCCCAGG - Intronic
1067944067 10:50679489-50679511 ACACCTCCACAGAGGGCGCCTGG - Intergenic
1070864879 10:79702312-79702334 ATGTCTCCACAGTGGCCACTGGG - Intergenic
1070878668 10:79840444-79840466 ATGTCTCCACAGTGGCCACTGGG - Intergenic
1071631773 10:87224533-87224555 ATGTCTCCACAGTGGCCACTGGG - Intergenic
1071645227 10:87356754-87356776 ATGTCTCCACAGTGGCCACTGGG - Intergenic
1073242850 10:102069431-102069453 AATTCTACTCAGTGGGCCCCTGG + Intergenic
1074535515 10:114325895-114325917 AGGTCTCCCCAGTGGGTCCCAGG + Intronic
1075073700 10:119336257-119336279 ACGGCTCCACAGTTTGCCCAGGG + Intronic
1076871534 10:133197309-133197331 AAGGCCCCACAGTGGCCCCCAGG + Intronic
1077103352 11:831797-831819 GGCTCTCCCCAGTGGGCCCCAGG + Exonic
1082800165 11:57408865-57408887 GGGTTTCCACAGTTGGCCCCAGG - Intronic
1082884276 11:58066959-58066981 TCGTGTCCACAGTGGGGCACAGG + Intronic
1084068349 11:66718413-66718435 TCGTCCCCACAGGGGGCCCCCGG + Intronic
1084654889 11:70509369-70509391 GTGTCCCCACACTGGGCCCCTGG - Intronic
1085388192 11:76169133-76169155 AGGCCACCACAGAGGGCCCCTGG + Intergenic
1085451979 11:76639629-76639651 CAGTCTCCACAGTGGGCGACAGG + Intergenic
1089110973 11:116055764-116055786 ACACCTCCACAGTGGTCCCGTGG - Intergenic
1091546294 12:1503387-1503409 ACGACTCCACAGTGAGCACGGGG + Intergenic
1091820204 12:3470524-3470546 ACGGCTTCACAGTGAGGCCCTGG - Intronic
1092030193 12:5277433-5277455 ACGGCTCCACAGTGGGTGGCGGG - Intergenic
1096561371 12:52438136-52438158 CCTTCTCCACACTCGGCCCCTGG - Intergenic
1096561379 12:52438178-52438200 CCTTCTCCACACTCGGCCCCTGG - Intergenic
1096561387 12:52438220-52438242 CCTTCTCCACACTCGGCCCCTGG - Intergenic
1096561395 12:52438262-52438284 CCTTCTCCACACTCGGCCCCTGG - Intergenic
1096869072 12:54582177-54582199 GCGTCTCCCCTGTGGGCCTCCGG + Intronic
1096878721 12:54649999-54650021 TCATCTCCACAGTGTGACCCAGG + Intergenic
1099056138 12:77843348-77843370 AGGTCTGCACTGTGGACCCCAGG + Intronic
1103698771 12:122836467-122836489 ACGTCTGCATCGTGGGTCCCCGG - Intronic
1104676324 12:130714623-130714645 AGGGCTCCACTCTGGGCCCCAGG + Intronic
1104718351 12:131031083-131031105 AACTCACCACACTGGGCCCCGGG + Intronic
1113054813 13:106256753-106256775 AGGTCTCTACAGGGGGCCTCTGG + Intergenic
1113598123 13:111548566-111548588 ATGTCTCCTGAGTGAGCCCCCGG + Intergenic
1115203305 14:30875309-30875331 ACGTCCCCCCACTGGACCCCAGG - Intronic
1122662890 14:103309776-103309798 AGGCCACCACAGTGGTCCCCAGG + Intergenic
1124007995 15:25810128-25810150 ACGTCCCCACTGTGGGTCACTGG - Intronic
1126328883 15:47510724-47510746 ACTTCTCCACAAGGAGCCCCAGG - Intronic
1127883067 15:63174957-63174979 CTCTCTACACAGTGGGCCCCAGG + Intergenic
1129916854 15:79282216-79282238 ACGACTCCACAGGAGGCCCTGGG + Intergenic
1131179184 15:90228576-90228598 AGGTATCCCCAGTGTGCCCCCGG + Exonic
1132310501 15:100854138-100854160 CCCTCTCCACTGTGGGCCCGGGG - Intergenic
1132853947 16:2036544-2036566 ACCTGTCCACACTGGGGCCCTGG + Intronic
1133007810 16:2894504-2894526 ACGGCCCCAGAGTGGCCCCCAGG + Intronic
1133333650 16:4991996-4992018 CCGCCTCCAGAGCGGGCCCCAGG - Exonic
1135985250 16:27179237-27179259 CCATCTCCACAGAGAGCCCCAGG - Intergenic
1136280502 16:29206231-29206253 AGGTCTGCAGAGAGGGCCCCTGG + Intergenic
1136771925 16:32847700-32847722 ACGTGTCCATAGTGGGGCACAGG - Intergenic
1136898684 16:34013821-34013843 ACGTGTCCATAGTGGGGCACAGG + Intergenic
1140777572 16:78264160-78264182 TCATCACCACAGAGGGCCCCAGG + Intronic
1142084869 16:88172190-88172212 AGGTCTGCAGAGAGGGCCCCTGG + Intergenic
1142476789 17:193630-193652 AGCTTTCCACAGTGGTCCCCTGG + Intergenic
1145761707 17:27429350-27429372 CCGTCTCCACAGTGGGTGACTGG - Intergenic
1148290134 17:46439102-46439124 CAGCCTCCCCAGTGGGCCCCAGG + Intergenic
1148312302 17:46656675-46656697 CAGCCTCCCCAGTGGGCCCCAGG + Intronic
1151656680 17:75499496-75499518 GCTCCTCCACAGTGAGCCCCAGG - Exonic
1152944198 17:83190270-83190292 ACGTCTACACAGCTCGCCCCAGG - Intergenic
1156468702 18:37364000-37364022 GCCTCTCCTCAGAGGGCCCCTGG - Intronic
1160783107 19:886625-886647 AGGTCTGCACAGTGCGGCCCAGG - Intronic
1161017026 19:1988139-1988161 TCCTCTCCACGGTGGGCCCTAGG + Intronic
1162189019 19:8930207-8930229 GAGTCTCCGCAGTGGGCCCTGGG - Intronic
1162289497 19:9768437-9768459 ACGTCTCCACCGGGGACCCTGGG + Exonic
1164705728 19:30318034-30318056 CCGTCTCCACAGTGGCACGCAGG + Intronic
1165441929 19:35833387-35833409 AGGACTCCACAGTGGGCACATGG + Intronic
928234415 2:29527453-29527475 TCATCTCCACAGTGGCACCCTGG - Intronic
934852854 2:97712543-97712565 GAGTCTCCACAGTGGGCCCAGGG + Intergenic
947936001 2:234004123-234004145 CTGTCTCCCAAGTGGGCCCCTGG + Intronic
948640386 2:239372156-239372178 ACTCCTGGACAGTGGGCCCCAGG + Intronic
948894011 2:240919896-240919918 CTGTCTCCACGGTGGGACCCTGG - Intronic
949036075 2:241816315-241816337 ACGGCTGCCCAGTGGGCTCCGGG - Exonic
1170316562 20:15047889-15047911 ATGTCTTCACTGTGGGTCCCAGG - Intronic
1170539938 20:17377427-17377449 AAGTGTGCACATTGGGCCCCAGG + Intronic
1172633369 20:36393542-36393564 AGGTCTCCACACCGAGCCCCTGG + Intronic
1174401019 20:50275992-50276014 AGGTCTCCTCAGTGGGCAACAGG - Intergenic
1176072311 20:63233764-63233786 CCAACTCCCCAGTGGGCCCCAGG + Intergenic
1176127677 20:63483235-63483257 AGGCCTCCACAATGGGACCCCGG - Intergenic
1176863843 21:14030887-14030909 ACGTGTACACAGTGTGCCCAAGG + Intergenic
1177664646 21:24138896-24138918 ATGTCTCAACAGTGGGCTTCAGG - Intergenic
1178429536 21:32506847-32506869 ACATCCCCACAGTGGGGCCGGGG - Intronic
1179375507 21:40846925-40846947 CCGTCAGCTCAGTGGGCCCCCGG + Exonic
1180140881 21:45892846-45892868 CCGTCTCCACTGTGGGTGCCAGG + Intronic
1183493887 22:38131138-38131160 ACGTGTTCACAGGGGTCCCCAGG - Intronic
1184774040 22:46614595-46614617 CTGTCTCCACGGTTGGCCCCTGG - Intronic
950423735 3:12913606-12913628 ACTTCTCCACTGCGGCCCCCAGG - Intronic
953031908 3:39185118-39185140 ACCTCACCACAGTGGGGCCCCGG - Exonic
953240517 3:41144636-41144658 CTGTTTCCACAGTGGCCCCCTGG - Intergenic
953352135 3:42223488-42223510 ACCCCTCCTCTGTGGGCCCCCGG + Exonic
955325821 3:58008876-58008898 TCGGCACCACAGTGGGCGCCTGG - Intronic
957046703 3:75381216-75381238 ACATCCCCACAGTGGGGCCGGGG + Intergenic
960290785 3:115881913-115881935 AATTCTCCAGAGAGGGCCCCAGG - Intronic
961878768 3:130045284-130045306 ACATCCCCACAGTGGGGCCGGGG + Intergenic
963865183 3:150352891-150352913 AGGTCTTGAGAGTGGGCCCCTGG + Intergenic
964170143 3:153760080-153760102 GCTTCTCCACACTGGGCCCTTGG + Intergenic
964446200 3:156761268-156761290 AAGCCACCACAGTGGGCCCCAGG + Intergenic
969824348 4:9745203-9745225 ACATCCCCACAGTGGGGCCGGGG - Intergenic
973051256 4:45601051-45601073 ACGGATCCACAGTAGCCCCCAGG + Intergenic
975669064 4:76761972-76761994 ACCTTTCCACAGTGGGCTTCTGG - Intronic
983507969 4:168575815-168575837 ACTTTTCAACAGTGGTCCCCAGG - Intronic
985543845 5:499556-499578 ACGTTTCCACACAGGGACCCTGG - Intronic
987138641 5:14922609-14922631 TCCTCTCCATAGTGCGCCCCGGG - Intergenic
1002300791 5:178256387-178256409 ATGTCTCCACAGGGGGAGCCTGG - Exonic
1004379839 6:15123288-15123310 ATGTTTCTTCAGTGGGCCCCAGG + Intergenic
1016992310 6:149938605-149938627 ACGTCTCCACACTGAGCCGGTGG + Intergenic
1017949218 6:159121690-159121712 ACTTCTCCATATTGTGCCCCTGG - Intergenic
1019572688 7:1720300-1720322 ACGTCTCCACAGTGGGCCCCAGG + Intronic
1019599398 7:1873775-1873797 ACGTCTCCCCACTGGGCTTCAGG - Intronic
1019894476 7:3972921-3972943 CCGTCTCCAGGGTGGCCCCCAGG - Intronic
1022691639 7:32662127-32662149 ACCTCTCCACTGTGTGCTCCAGG + Intergenic
1022919261 7:34996364-34996386 ACCTCTCCACTGTGTGCTCCAGG + Intronic
1025812679 7:64885109-64885131 ACGTGTCCACAAAGGTCCCCTGG - Intronic
1027247804 7:76379235-76379257 GGGTCTCCAGAGTGGGCCCTGGG - Intergenic
1035617128 8:1010902-1010924 CAGTCTACACAGTGGGCCCCAGG + Intergenic
1035617297 8:1011811-1011833 CAGTCTGCACAGTGGGCCCTGGG + Intergenic
1035650115 8:1257588-1257610 GCGTCTCCTCTGTGGGCCCCGGG + Intergenic
1046659908 8:116938233-116938255 GCGTCTCCGCGATGGGCCCCGGG + Exonic
1048853131 8:138663280-138663302 AGGTCTCCACAGTGGCTCCCGGG + Intronic
1049386740 8:142346734-142346756 AGGTCGGCACAGTGGGTCCCAGG + Intronic
1053057547 9:35002866-35002888 ACCTCTGCACAGTGAGGCCCTGG - Intergenic
1053104343 9:35397386-35397408 ACCTCTCCACTGTGGCCTCCTGG + Intronic
1054374124 9:64436998-64437020 ACGCCTCCTCAGTGGGGACCTGG + Intergenic
1057271360 9:93653461-93653483 GCGACTCCCCAGAGGGCCCCTGG + Intronic
1060960960 9:127680379-127680401 AGGTCTGCACAGTGGTCCCACGG + Intronic
1061235636 9:129341285-129341307 ACGTCCCCACAGTGGCCCTGGGG + Intergenic
1061271639 9:129547104-129547126 CCCTCTCCCCAGAGGGCCCCAGG + Intergenic
1062627150 9:137448476-137448498 CTGGCACCACAGTGGGCCCCTGG - Exonic
1190526257 X:51332471-51332493 GCGCCTGCGCAGTGGGCCCCAGG + Intronic
1194738160 X:97539306-97539328 AGGTCTCCACAGAAGGCCCAAGG + Intronic
1200103220 X:153698684-153698706 ACCTCTCCCCAGGGTGCCCCAGG + Intergenic
1201784811 Y:17763567-17763589 AGGACTCCACTGTGGGCCACAGG + Intergenic
1201816741 Y:18142420-18142442 AGGACTCCACTGTGGGCCACAGG - Intergenic