ID: 1019574379

View in Genome Browser
Species Human (GRCh38)
Location 7:1729326-1729348
Sequence GAACCCTGAGCAAAAGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019574379_1019574385 -2 Left 1019574379 7:1729326-1729348 CCAGCTTCTTTTGCTCAGGGTTC No data
Right 1019574385 7:1729347-1729369 TCTTGGGTCAGGCACTGGGAAGG No data
1019574379_1019574389 12 Left 1019574379 7:1729326-1729348 CCAGCTTCTTTTGCTCAGGGTTC No data
Right 1019574389 7:1729361-1729383 CTGGGAAGGGCTCAGCAGGGCGG No data
1019574379_1019574386 -1 Left 1019574379 7:1729326-1729348 CCAGCTTCTTTTGCTCAGGGTTC No data
Right 1019574386 7:1729348-1729370 CTTGGGTCAGGCACTGGGAAGGG No data
1019574379_1019574384 -6 Left 1019574379 7:1729326-1729348 CCAGCTTCTTTTGCTCAGGGTTC No data
Right 1019574384 7:1729343-1729365 GGGTTCTTGGGTCAGGCACTGGG 0: 1
1: 0
2: 0
3: 22
4: 230
1019574379_1019574388 9 Left 1019574379 7:1729326-1729348 CCAGCTTCTTTTGCTCAGGGTTC No data
Right 1019574388 7:1729358-1729380 GCACTGGGAAGGGCTCAGCAGGG No data
1019574379_1019574387 8 Left 1019574379 7:1729326-1729348 CCAGCTTCTTTTGCTCAGGGTTC No data
Right 1019574387 7:1729357-1729379 GGCACTGGGAAGGGCTCAGCAGG No data
1019574379_1019574383 -7 Left 1019574379 7:1729326-1729348 CCAGCTTCTTTTGCTCAGGGTTC No data
Right 1019574383 7:1729342-1729364 AGGGTTCTTGGGTCAGGCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019574379 Original CRISPR GAACCCTGAGCAAAAGAAGC TGG (reversed) Intronic