ID: 1019574782

View in Genome Browser
Species Human (GRCh38)
Location 7:1732128-1732150
Sequence GGTCACAGCGGAGCAAGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 146}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019574780_1019574782 -10 Left 1019574780 7:1732115-1732137 CCTGGCAGCGTGGGGTCACAGCG 0: 1
1: 0
2: 2
3: 9
4: 130
Right 1019574782 7:1732128-1732150 GGTCACAGCGGAGCAAGCACAGG 0: 1
1: 0
2: 2
3: 9
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019574782 Original CRISPR GGTCACAGCGGAGCAAGCAC AGG Intronic
900083887 1:877601-877623 TGTCCTAGGGGAGCAAGCACAGG + Intergenic
900191897 1:1355597-1355619 GGTCCCAGTGGAGCACGCGCTGG + Exonic
900945913 1:5831353-5831375 GGTCACAGAGGAGGAAGCCAAGG + Intergenic
907354720 1:53862890-53862912 GGTGACAGTGGAGCTAGGACTGG + Intronic
907740749 1:57163429-57163451 GATCACAGCAGAGCAAGCAAGGG + Intronic
912683745 1:111745779-111745801 GGTTACAGGGCAGCCAGCACTGG - Intronic
913369179 1:118077884-118077906 AGACACAGTGGAGGAAGCACTGG + Intronic
915314197 1:155018718-155018740 GGCCTCAGCAGAGGAAGCACGGG - Exonic
916648780 1:166816230-166816252 GGTCTCAGCAGAGGAAGCCCTGG + Intergenic
917350518 1:174072610-174072632 GCTCACAGCATAGCAAGCAAGGG - Intergenic
920047731 1:203144650-203144672 GGTCACCCAGCAGCAAGCACTGG - Intronic
924243849 1:242062940-242062962 TGTCCTAGGGGAGCAAGCACAGG + Intergenic
924901225 1:248402685-248402707 GGTCATAGGGAAGCAAGCAAAGG + Intergenic
1062763354 10:44334-44356 TGTCCTAGGGGAGCAAGCACAGG - Intergenic
1063571347 10:7216818-7216840 GGACACAGAGGAGGAAGAACAGG - Intronic
1064964159 10:20998906-20998928 GGTCACACCGCAGCAAGTTCTGG + Intronic
1067102404 10:43342832-43342854 GGGCCCAGCGCAGCAGGCACTGG - Intergenic
1067538969 10:47137950-47137972 GGACACCTGGGAGCAAGCACAGG + Intergenic
1074491851 10:113945632-113945654 GGTCAGAGGGGAGCAGGCCCTGG - Intergenic
1074649942 10:115509549-115509571 GGTGAAGGCGGAGCAGGCACAGG - Intronic
1074971761 10:118544786-118544808 GGTCACTGCTGAGCAACCTCTGG - Intergenic
1077412515 11:2410275-2410297 GGCCAGACCGGAGCAAACACAGG - Intronic
1079009126 11:16814002-16814024 GGTCACAGCCAAGCAAGCTAGGG + Intronic
1079770699 11:24454870-24454892 GGTCACTGCGCAGCAATGACTGG - Intergenic
1081657271 11:44865797-44865819 GGTCTCAGTGGAGCAGGAACAGG + Intronic
1081727677 11:45342570-45342592 GGTCACAGCAAGGCAGGCACAGG + Intergenic
1083293997 11:61705485-61705507 GAGCAGAGCGGAACAAGCACTGG - Intronic
1084019874 11:66411059-66411081 GGACACAGGGGAGTAAGTACTGG - Intergenic
1085258168 11:75188892-75188914 GGTCATAGATGAGCCAGCACAGG - Intronic
1085516346 11:77114098-77114120 GGCCACGGCGGAGCCAACACTGG - Intronic
1086029883 11:82341556-82341578 GGTCACACAGGAAAAAGCACTGG + Intergenic
1094813229 12:34162093-34162115 TGTCCTAGGGGAGCAAGCACAGG - Intergenic
1095375481 12:41523071-41523093 GGTCACACAGGACTAAGCACTGG - Intronic
1100509625 12:95256400-95256422 GGTCAGAGAGGAGCTAACACTGG - Intronic
1104016358 12:124964929-124964951 GGCCCCAGAGAAGCAAGCACAGG - Exonic
1105498799 13:20953432-20953454 CGTCACAGCTCAGCAAGGACAGG - Intergenic
1107404216 13:40097898-40097920 GGTCACAGCCCAGCAAGAAGTGG + Intergenic
1107404372 13:40098859-40098881 GGTCACAGCCCAGCAAGAAGTGG + Intergenic
1113110219 13:106814643-106814665 GGTCACAGAGGAGTCAGAACTGG - Intergenic
1113117121 13:106885405-106885427 GGGGACAGTGGAGCACGCACTGG - Intergenic
1114141995 14:19922773-19922795 GATCACAGGGGAGACAGCACAGG - Intergenic
1119248216 14:73131130-73131152 GGTCACTGAGGAGGAAGCAGAGG + Intergenic
1120077070 14:80171049-80171071 AGCCACAGTGGTGCAAGCACTGG + Intergenic
1122108618 14:99480345-99480367 GGGGACAGCGGGGCAAGCTCGGG + Intronic
1123092413 14:105747675-105747697 GGCCCAAGCGGAGCCAGCACGGG - Intergenic
1124203546 15:27698509-27698531 GGTCACAGGGGCTCAAGCAAAGG + Intergenic
1125484094 15:40100431-40100453 GCTCACAGAGGAGCAAACAGGGG + Intronic
1126688159 15:51266269-51266291 GGACAGAGCAGGGCAAGCACTGG + Intronic
1128047795 15:64634338-64634360 GTTCTCAGCGGAGCTACCACAGG - Intronic
1131145599 15:90009590-90009612 GGACACAGAGGAACAAGCAGTGG - Intronic
1131387501 15:92019298-92019320 AGTCACAGAGGAGCAAGCTGAGG - Intronic
1132567369 16:629698-629720 GGTCACAGCTGAGCTGGAACGGG + Intronic
1132813670 16:1815574-1815596 GGTCACAGCAGAGCAACAGCTGG + Intronic
1132956466 16:2596928-2596950 GGTCACAGGGGATGCAGCACAGG - Intronic
1135004951 16:18812179-18812201 GGGCAGAGTGGAGCAAGCACGGG + Intronic
1136418342 16:30116935-30116957 GATCACAGTGGAGGAAGCGCTGG - Exonic
1141134582 16:81457223-81457245 CGCCACAGGGGAGCAAGCCCTGG - Intronic
1141797692 16:86286179-86286201 GGTCACCGCAGGGCATGCACTGG + Intergenic
1142703084 17:1676337-1676359 CATCACAGCGGAGGAAGCAGTGG - Exonic
1143726507 17:8850577-8850599 GGTCACAGTGGAGCAGACAGAGG - Intronic
1144437420 17:15254278-15254300 AGTCACAGAGGAGCAAGAAAGGG + Intronic
1144627706 17:16853125-16853147 GGTCACACAGCAGCAAGCCCTGG + Intergenic
1144878736 17:18419598-18419620 GGTCACAGAGCAGCAAGCCCTGG - Intergenic
1145153501 17:20524797-20524819 GGTCACAGAGCAGCAAGCCCTGG + Intergenic
1145159276 17:20563595-20563617 GGTCACAGAGCAGCAATCCCTGG + Intergenic
1145899076 17:28478233-28478255 GGTCACAGCGGGGGCACCACCGG - Intronic
1146627006 17:34442538-34442560 GGTCACAGAGCAGCCAGGACTGG + Intergenic
1147170278 17:38614460-38614482 GGACACAAAGGAGCAACCACAGG - Intergenic
1150609768 17:66724552-66724574 GCTCAGAGCAGAGCATGCACTGG - Intronic
1151150333 17:72079655-72079677 GGAAACAGCGGAGTAAGGACAGG + Intergenic
1152019328 17:77772210-77772232 GGTCACACAGGAGCCAGGACTGG - Intergenic
1152218186 17:79046612-79046634 GGTCACAGCAGCGCAAGCACCGG - Exonic
1152897048 17:82918098-82918120 AGTCACCGCGGAGGAAGCATGGG - Intronic
1152956264 18:44665-44687 TGTCCTAGGGGAGCAAGCACAGG - Intergenic
1153580550 18:6569238-6569260 GGACACAGGGGAGCCAGCACTGG - Intronic
1156497497 18:37535742-37535764 GGCCACAGAGGAGCATGCTCAGG + Intronic
1156600419 18:38598961-38598983 AGTCACAGCGGGGCTAGCCCAGG + Intergenic
1157313555 18:46570357-46570379 GGGCAAAGAGGAGGAAGCACTGG + Intronic
1163117126 19:15195611-15195633 GGGCACGGCCGAGCAAGCAAGGG + Intronic
1164540932 19:29121038-29121060 GGTCACATTGGGCCAAGCACTGG + Intergenic
928441552 2:31296369-31296391 GTTTACAGAGGAGAAAGCACAGG - Intergenic
932359801 2:71094769-71094791 GGTCACAGTGAAGCAAGCTGTGG + Intergenic
934769009 2:96896095-96896117 GCTCACAGCTGTGCAAGCATAGG + Intronic
934854011 2:97717949-97717971 GATCACAGCAGAGCAGCCACGGG - Intronic
937094981 2:119229447-119229469 GGCCACAGCAGAGCAAGGAAAGG + Intronic
941927013 2:170905981-170906003 GGACACTGCAGAGCCAGCACGGG + Intergenic
943647011 2:190417404-190417426 GTTCAAACAGGAGCAAGCACAGG - Intronic
947200682 2:227612162-227612184 GGTCACATGGGAGGCAGCACCGG - Intronic
1172257432 20:33531325-33531347 GCTCAGAGCGGGGAAAGCACAGG + Intronic
1172737073 20:37134878-37134900 TGTCACAGGGGAGCAAGGACTGG - Intronic
1175114558 20:56673043-56673065 GTTCACAGCAAAGCACGCACGGG + Intergenic
1175815473 20:61881143-61881165 GGTCACAGCAGAGCAGGGTCAGG + Intronic
1175823897 20:61926222-61926244 GGAACCAGAGGAGCAAGCACGGG + Intronic
1176196232 20:63837344-63837366 GGACATAGTGGAGCAGGCACGGG + Intergenic
1179436158 21:41363602-41363624 GGTCATGGCTGACCAAGCACTGG - Intronic
1179553419 21:42157542-42157564 GGTCACAGCGGTGAAAGAACGGG + Intergenic
1180667903 22:17529307-17529329 GAGCAGAGCAGAGCAAGCACAGG + Intronic
1181128955 22:20718165-20718187 GGTCAGAGCAGTGTAAGCACTGG + Intronic
1181131770 22:20736326-20736348 GGCCACAGCACAGCAAGCAAGGG + Intronic
1181317322 22:21979094-21979116 GCCCACAGCAGAGGAAGCACTGG + Intronic
1182333657 22:29569021-29569043 GGGCACAGGGGAGCCAGGACAGG + Intronic
1185118349 22:48950743-48950765 GGTCGCGGAGGAGCCAGCACAGG - Intergenic
1185204737 22:49531336-49531358 GGGCACCGCGGAGGAAGCGCAGG + Intronic
952532416 3:34275998-34276020 GGCCACAGGGGAGCCAACACAGG + Intergenic
954293495 3:49661906-49661928 CCTCAAAGCGCAGCAAGCACCGG + Exonic
955052649 3:55427530-55427552 GATAACAGCACAGCAAGCACAGG + Intergenic
955185540 3:56711681-56711703 GGTCCCACCACAGCAAGCACCGG - Intergenic
958878088 3:99638381-99638403 GGTCACAACGGAGGAAGGAGTGG - Intergenic
961391273 3:126553549-126553571 GAACACAGCGGTGCATGCACAGG - Intronic
962384977 3:134925554-134925576 GGTCACCGGGGAGAGAGCACTGG + Intronic
963634105 3:147772068-147772090 GGTCACAGTTGAGGAAGCAAAGG + Intergenic
963947679 3:151164097-151164119 GGGCACAGTGGGTCAAGCACAGG + Intronic
967079522 3:186036552-186036574 GTTCACAGACGAGCAGGCACCGG + Intergenic
968358073 3:198123576-198123598 TGTCCTAGGGGAGCAAGCACAGG + Intergenic
968581819 4:1398813-1398835 GGACACTGCGGGGCAAGGACAGG + Intergenic
968913548 4:3487432-3487454 GGTCACAGCGGGCTCAGCACAGG - Intronic
971750977 4:30647408-30647430 GATCATAGCGGAGGAAGTACAGG - Intergenic
972251592 4:37308554-37308576 GGTCCCTGGGGAGCATGCACAGG + Intronic
976549550 4:86379041-86379063 GGTCACAGCACAAAAAGCACAGG + Intronic
985211278 4:187598131-187598153 AGTCAGAGGGGATCAAGCACTGG + Intergenic
986327148 5:6684873-6684895 GAACACAGTGGAGCAGGCACCGG - Intergenic
990946725 5:61256816-61256838 TGTCACAGGGGAGCAAAAACGGG + Intergenic
996090775 5:119349513-119349535 CGCATCAGCGGAGCAAGCACTGG - Intronic
996545210 5:124670803-124670825 AGTGACAGCAGAGCAACCACTGG + Intronic
997884066 5:137615170-137615192 AGTCACATAGGAGCAAGAACAGG + Intergenic
998120758 5:139575132-139575154 AGTCAAAGCAGAGCAAGTACGGG - Intronic
999706631 5:154278706-154278728 GGTTACAGGGGAGTAAGAACGGG - Intronic
1001533520 5:172481844-172481866 GGTCACACAGCAGCAAGCAGTGG + Intergenic
1002067978 5:176661867-176661889 GGACACAGCGGACCAAGCAGGGG + Intergenic
1002198248 5:177512758-177512780 GGTCAGGGTGGTGCAAGCACTGG - Exonic
1002211559 5:177602402-177602424 GGCCCCAGCACAGCAAGCACAGG - Intronic
1002358219 5:178648294-178648316 GGTCACAGCAGAGCAAGAACAGG + Intergenic
1007776262 6:44226119-44226141 GGTCAGAGCAGAGCAAGCCTGGG - Exonic
1010859843 6:80897222-80897244 AGTCACAGAGGACCAAGAACTGG + Intergenic
1018384131 6:163287512-163287534 GGTCACACCTGAGCCAGCTCTGG + Intronic
1019313870 7:375779-375801 AGGCACAGCGGGGCCAGCACTGG + Intergenic
1019530493 7:1500593-1500615 GGACACAGCGGAGCCAGGACTGG - Intronic
1019574782 7:1732128-1732150 GGTCACAGCGGAGCAAGCACAGG + Intronic
1019598342 7:1868839-1868861 GGGCCCAGCGGTGCAAGCCCTGG + Intronic
1029031853 7:97476898-97476920 AGTCACACAGAAGCAAGCACAGG - Intergenic
1031234228 7:119152237-119152259 GGTTCCAGAAGAGCAAGCACAGG - Intergenic
1038747257 8:30265411-30265433 GGTGAAGGGGGAGCAAGCACAGG - Intergenic
1039469365 8:37803782-37803804 TGTCACAGAGGAGCAGGCAATGG + Intronic
1040532777 8:48279123-48279145 GGTCACAGAGAAGGAAGCATTGG + Intergenic
1043218957 8:77634131-77634153 GTTCACAGCACAGCAAACACAGG - Intergenic
1049051156 8:140197780-140197802 TGTCACGGGGGAGCCAGCACGGG + Intronic
1049256046 8:141614433-141614455 GGTCACAGCGGAGAGGTCACAGG - Intergenic
1049599299 8:143499676-143499698 GCTCACAGTAGAGCCAGCACCGG + Intronic
1061291975 9:129655548-129655570 GGACCCAGCAGAGCAAGGACAGG - Intergenic
1061689263 9:132312134-132312156 GCCCACAGCGGAGCAGCCACAGG - Intronic
1062111319 9:134783562-134783584 GGTGACAGCTGTGCACGCACCGG + Intronic
1062444156 9:136586430-136586452 GGACTCAGGTGAGCAAGCACTGG - Intergenic
1062741940 9:138180111-138180133 TGTCCTAGGGGAGCAAGCACAGG + Intergenic
1189066560 X:37815959-37815981 TGTCCCAGCGGAATAAGCACTGG - Intronic
1190548706 X:51556939-51556961 GGTTACAGTGGGGCAAGCAGAGG - Intergenic
1197706475 X:129638117-129638139 GGTCTCAGCAGAGGGAGCACAGG - Intergenic
1199910733 X:152284089-152284111 GGGCACAGCAGAACAAGCAAGGG - Intronic
1201701155 Y:16883668-16883690 GCACACAGGTGAGCAAGCACAGG + Intergenic