ID: 1019574912

View in Genome Browser
Species Human (GRCh38)
Location 7:1732857-1732879
Sequence CGGGGAAAGGCTGTGTGATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 283
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 257}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019574907_1019574912 6 Left 1019574907 7:1732828-1732850 CCACAGTGGGGACGGCGCTGAAC 0: 1
1: 0
2: 0
3: 6
4: 66
Right 1019574912 7:1732857-1732879 CGGGGAAAGGCTGTGTGATGAGG 0: 1
1: 0
2: 2
3: 23
4: 257
1019574902_1019574912 25 Left 1019574902 7:1732809-1732831 CCTGGGAAGTGAGCTCAAGCCAC 0: 1
1: 0
2: 1
3: 17
4: 247
Right 1019574912 7:1732857-1732879 CGGGGAAAGGCTGTGTGATGAGG 0: 1
1: 0
2: 2
3: 23
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019574912 Original CRISPR CGGGGAAAGGCTGTGTGATG AGG Intronic
900372092 1:2336663-2336685 CAGGGATAGTCTGAGTGATGTGG + Intronic
900546189 1:3230616-3230638 CGGGGAAAGGTGGTGTGAGATGG - Intronic
900977328 1:6025836-6025858 CCGGGATCGGCTGTGTGCTGGGG - Intronic
901449527 1:9327461-9327483 CCAGGAAAGGCTGTGCCATGGGG + Intronic
901833347 1:11907318-11907340 CTGGGAAAGGCTGTGAAATGAGG - Intergenic
902814498 1:18908444-18908466 CAGAGAAAGTCTGTGTGGTGTGG + Exonic
904429353 1:30451928-30451950 CAGTGAAGGGCTGGGTGATGCGG - Intergenic
905256446 1:36688495-36688517 AGGGGAAAGGATGTGGGAAGGGG + Intergenic
905256580 1:36688855-36688877 AGGGGAAAGGGTGTGGGAAGGGG + Intergenic
905527465 1:38649849-38649871 AGGTGAAAGGCTGTGAGGTGAGG + Intergenic
906240329 1:44238733-44238755 TGGGGGGAGGCTATGTGATGGGG - Intronic
909793519 1:79703287-79703309 AGGGGAAAGACTGTATGAAGGGG - Intergenic
909975618 1:82043083-82043105 CAGGGAAATGCTGGGTGCTGGGG - Intergenic
912504471 1:110146673-110146695 GGGGGGAAGGGTGTGAGATGAGG + Intergenic
912582918 1:110736252-110736274 TGGGGTCAGGCTGTGTGATTTGG + Intergenic
914005413 1:143728639-143728661 CTGGCAATGGCTGTGGGATGCGG + Intergenic
914097893 1:144559898-144559920 CTGGCAATGGCTGTGGGATGCGG + Intergenic
914301098 1:146377715-146377737 CTGGCAATGGCTGTGGGATGCGG - Intergenic
918469515 1:184857027-184857049 AAAGGAAATGCTGTGTGATGAGG - Intronic
919678731 1:200411875-200411897 GGGGGAAAGTCTGTGGGAAGGGG - Intergenic
920288703 1:204901086-204901108 ATGGGAAAGGCTGTGTGTGGTGG + Intronic
921282930 1:213585284-213585306 GAGGGAAAGTCTGTGTGATGAGG - Intergenic
922438429 1:225629296-225629318 CAGGGAAAGGCTGGGCGCTGTGG + Intronic
924816148 1:247443679-247443701 CGGAGGAAAGCTGTGTGAGGAGG + Intronic
1064264199 10:13811725-13811747 GGAGGAAAGGCTGTCTGATGCGG + Intronic
1065073749 10:22055036-22055058 AGGGGAGAGGCTGAGAGATGGGG - Intergenic
1066658443 10:37716816-37716838 AGAGGAAAGGCTGTTTGCTGAGG - Intergenic
1067042952 10:42966501-42966523 AGAGGAAAGGCTGTTTGCTGAGG - Intergenic
1067480374 10:46592850-46592872 CTGAGAAAGGCTGGGTGAGGTGG - Intronic
1067614363 10:47748949-47748971 CTGAGAAAGGCTGGGTGAGGTGG + Intergenic
1068752946 10:60617381-60617403 TGGGGAAAGTCTGTGAGAGGTGG - Intronic
1069533637 10:69237078-69237100 AAGGGGAAGGCTGTGTGAGGAGG + Intronic
1070269668 10:74940731-74940753 GGGGGAAAGGCTGGGTGCAGTGG - Intronic
1071474942 10:86018000-86018022 CTGGGAGAGTCTGTGTGAGGAGG - Intronic
1071629769 10:87208925-87208947 CTGAGAAAGGCTGGGTGAGGTGG + Intergenic
1072263207 10:93702362-93702384 AAGGGAAAGGGTGTGTGAGGAGG - Exonic
1072572451 10:96670593-96670615 GGGGGAAGGGCTGTGTGAGAGGG + Intronic
1074366130 10:112858992-112859014 CAGGGAAGGGTTGTGTGTTGTGG - Intergenic
1074778830 10:116785804-116785826 CGGGGAAAGGCAGAGTCAAGTGG - Intergenic
1075598807 10:123752141-123752163 GCATGAAAGGCTGTGTGATGTGG - Intronic
1076100626 10:127774812-127774834 CTGGGAAAGGGTGTGTAATGAGG - Intergenic
1076226314 10:128779110-128779132 GTGGGAAAGGCAGTGTGCTGTGG - Intergenic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077424648 11:2468934-2468956 AGTGGAACGGCTGTGTCATGGGG + Intronic
1077479182 11:2805220-2805242 GGGGGAAAGGCTCTGTGACCTGG - Intronic
1082034242 11:47631654-47631676 CATGGAAGGGATGTGTGATGAGG + Exonic
1082200349 11:49358878-49358900 GGGGGAAAGGCTCTGCCATGTGG + Intergenic
1083614331 11:64018895-64018917 CGGGCAGTGGCTGTGTGAGGTGG + Intronic
1084605253 11:70168448-70168470 CGGGGTGAGGCTGTCTGCTGGGG - Intronic
1085297378 11:75438786-75438808 GAGGAAAAGGCTGTGTGTTGCGG + Intronic
1086655321 11:89347329-89347351 GGGGGAAAGGCTCTGCCATGTGG - Intronic
1088844312 11:113652049-113652071 AAGGGAAAGGCAGTGAGATGGGG - Intergenic
1088891038 11:114044371-114044393 CGGGGAAGAGCTGTTTGATGCGG + Intergenic
1090372473 11:126266289-126266311 CGGGGAAAGGATGTGGGGTCAGG + Intronic
1091615924 12:2051743-2051765 ATGGGGAAGGCTGTGTGAGGAGG + Intronic
1096178450 12:49538333-49538355 GGCGGAAAGGGTGTGTGGTGGGG - Intergenic
1097108072 12:56636766-56636788 TGGGGAAATGCTGAGTTATGGGG - Intronic
1097755089 12:63399706-63399728 TGGGGAAAAGCTGAGTGTTGGGG - Intergenic
1097968524 12:65607521-65607543 CGTGGAAATGCAGTCTGATGAGG - Intergenic
1098872678 12:75834637-75834659 GGGGGTAAGGCTGTATGATGGGG - Intergenic
1099044988 12:77706582-77706604 CTGGGAAAGGCTGGGTGCGGTGG + Intergenic
1099206061 12:79727775-79727797 CTGGGAAAGGCTATGTGTTCTGG - Intergenic
1100341632 12:93684724-93684746 CAGGGAAAGCCTCTCTGATGAGG + Intronic
1101196249 12:102385771-102385793 TGGGGAAAGGCCATGTGAAGAGG - Intergenic
1103527125 12:121576529-121576551 CAGGGGAAGGCTGTGTAAAGGGG + Intronic
1103676102 12:122657101-122657123 AGGATAAAGGCTGTGTGAAGTGG + Intergenic
1104982964 12:132582291-132582313 CGGGGTAGGGGTGTGTGGTGGGG - Intronic
1110247658 13:73344522-73344544 CGGGGAAAGACTGGATGATCTGG + Intergenic
1110560568 13:76907341-76907363 TGGGGAAAGGCTGTGAGGTTTGG - Intergenic
1110625480 13:77650836-77650858 CAGGGAAAGTGTGTGTGTTGGGG + Intergenic
1111914405 13:94346054-94346076 CAGGGAAATGCCATGTGATGAGG - Intronic
1112439899 13:99417726-99417748 CAGGGAAAGGCTGCGGGCTGAGG + Intergenic
1112711840 13:102138317-102138339 CAGGGAGAGGCAGTGTGGTGAGG + Intronic
1112711882 13:102138609-102138631 CAGGGAGAGGCAGTGTGGTGAGG + Intronic
1113581620 13:111434076-111434098 TGGGGAAAGGCTTTGTTAAGGGG + Intergenic
1113800661 13:113084772-113084794 CGGGAAGACGCTGCGTGATGCGG + Intronic
1113949743 13:114065392-114065414 AGGGTAAAGGCTGCGTGAAGAGG + Intronic
1122271678 14:100571081-100571103 CGGGGAAGGACTGTGCCATGAGG - Intronic
1122842305 14:104472442-104472464 GGGGGAATGGGTGTGTGAGGTGG - Intergenic
1124201303 15:27680646-27680668 CATGGAAAGGCTGTGTGCGGAGG - Intergenic
1126357790 15:47814503-47814525 TGTTGAAAGGCAGTGTGATGTGG - Intergenic
1126891682 15:53212181-53212203 AGGGGCAAGGCTGTGTAGTGTGG - Intergenic
1129301439 15:74627934-74627956 TGGGGAGAGGCTGTGAGATCCGG - Intronic
1129385072 15:75191934-75191956 AGGGGACAGCCTGTGTGGTGGGG - Intergenic
1130184389 15:81665766-81665788 CGGGAAAATGCTGTGTGTGGCGG - Intergenic
1131152419 15:90055328-90055350 AGGGGAAAGCATGTGTGAAGAGG + Intronic
1133419124 16:5630645-5630667 CTGGGAAACGCTGGTTGATGAGG - Intergenic
1135037361 16:19089486-19089508 TGGGGAAGGGGTGTGTGTTGTGG - Intergenic
1136008339 16:27346400-27346422 CGGGGCTGGGCTGGGTGATGGGG + Intronic
1136272042 16:29154028-29154050 CTGGGAAAGGCTCTTTGATGAGG + Intergenic
1137591736 16:49697965-49697987 TGGGGAAAGGCGGCGTAATGGGG - Intronic
1137887764 16:52125216-52125238 TGGGGAAAGGCTTTGTGAAGAGG - Intergenic
1141559054 16:84854596-84854618 GGGGGGAAGGTTGTGTGCTGTGG - Intronic
1142075641 16:88116009-88116031 CTGGGAAAGGCTCTTTGATGAGG + Intronic
1142204527 16:88776576-88776598 AGGGGAGAGGCTGTGTGCTCAGG + Intronic
1142861341 17:2763840-2763862 AGTGGAAAGGGTGAGTGATGGGG + Intergenic
1143476325 17:7205698-7205720 GGGGGACGGGCTGTGGGATGGGG - Intronic
1143476333 17:7205717-7205739 GGGGGACGGGCTGTGGGATGGGG - Intronic
1144355267 17:14439540-14439562 AGAGGGAAGGCTGTATGATGAGG + Intergenic
1144440005 17:15272758-15272780 CTGGGAAGGCCTGTGTAATGAGG - Intergenic
1144929621 17:18848745-18848767 CCGGGAAAGCCTGTGGGAGGTGG + Intronic
1147189539 17:38730534-38730556 CGGGAAAAGCCTGTGAGCTGAGG - Intronic
1147782282 17:42952180-42952202 CAGGGAAAGGATGTGTGGTGGGG - Intronic
1149017269 17:51922890-51922912 CAAGGAAAGGCTTAGTGATGTGG - Intronic
1149471446 17:56919044-56919066 AGTGGAAATGCTGTGTCATGTGG + Intergenic
1149560831 17:57606867-57606889 TGGGGAAGGGCTGTGTGAGGTGG + Intronic
1151165360 17:72198623-72198645 AGGGGAAAGGATGTGAGATGGGG + Intergenic
1151488774 17:74419392-74419414 CTGGGAAAGGAGGTTTGATGGGG - Intergenic
1151535710 17:74737693-74737715 CTGGGAAGGGCTGGGAGATGGGG + Intronic
1151724188 17:75875202-75875224 AGGGGAGAGGCTGTGTTTTGGGG - Intronic
1152333360 17:79686132-79686154 CTGGGTAAGGCTGTGGCATGAGG + Intergenic
1152995741 18:405017-405039 CTGGGAATGTCTGTATGATGCGG + Intronic
1154241295 18:12657007-12657029 CGAGGAAAGGCTGTCTAATGTGG + Intronic
1154380926 18:13849155-13849177 CTGAGAAAGTCTGTGAGATGGGG - Intergenic
1155650425 18:28134348-28134370 GGGGGAAAGGCTGGGGGAAGGGG - Intronic
1156520188 18:37715676-37715698 CGGGGAAAGAGCGTGTGATGTGG + Intergenic
1158126911 18:54110318-54110340 CGGGTAAACTCTGTGTCATGGGG + Intergenic
1160333352 18:78015656-78015678 CGGGGAAGGGCTCTGTGCTGAGG - Intergenic
1160506879 18:79432314-79432336 CGGGGTGAGCCTGTGTGGTGAGG + Intronic
1160881366 19:1322223-1322245 CGGGGAAAGGAGGGGTGAAGGGG + Intergenic
1161568541 19:5017048-5017070 CGGGGAAAGGCTGCCTTGTGCGG + Intronic
1162096855 19:8315263-8315285 CCGGTAAAGGGTCTGTGATGAGG + Intronic
1162321498 19:9973549-9973571 CGGTGAGTGACTGTGTGATGTGG - Exonic
1163291331 19:16381279-16381301 CGTGGACCTGCTGTGTGATGTGG - Intronic
1163322188 19:16581340-16581362 CAGGGGAAGACTGTGCGATGAGG + Intronic
1166881618 19:45933790-45933812 TGGGGAAAGGGGGTGTGGTGGGG + Exonic
1167739651 19:51316872-51316894 CTGGGAAAGGCTGTGAGAAGGGG - Intronic
1168427255 19:56248808-56248830 CGGGGAGAGGCTGTGCCGTGTGG - Intronic
1168465427 19:56597464-56597486 CTGGGGAAGGCTGTGGAATGAGG - Intronic
1168545359 19:57245315-57245337 CAGGGAAGGGCTGGGTGAGGAGG - Intronic
926907168 2:17816643-17816665 CGGGGAAAGGCTCTGAGAGGGGG - Exonic
928753937 2:34501336-34501358 GGGGGACAGGCTGTATTATGGGG + Intergenic
930247554 2:49000634-49000656 CGGGGAAAGACTTTGTGAGAAGG + Intronic
931235110 2:60406404-60406426 CTGGGAAAGTCTGTGGGCTGAGG - Intergenic
934171229 2:89542563-89542585 CGGGGAAGGGCAGGGTGCTGTGG + Intergenic
934281535 2:91616881-91616903 CGGGGAAGGGCAGGGTGCTGTGG + Intergenic
934479516 2:94622311-94622333 CGGGGAAAGGCTCGGGCATGGGG + Intergenic
934628315 2:95884634-95884656 CGTGGATATGCTGAGTGATGAGG + Intronic
934686616 2:96326103-96326125 GAGGGAGAGGCTGAGTGATGAGG + Intronic
934805212 2:97216889-97216911 CGTGGATATGCTGAGTGATGAGG - Intronic
934832274 2:97540496-97540518 CGTGGATATGCTGAGTGATGAGG + Intronic
934832772 2:97547998-97548020 CGTGGATATGCTGAGTGATGAGG + Intronic
935051810 2:99530769-99530791 CAGGAAAAGGCTGAGGGATGAGG - Intergenic
935252142 2:101273069-101273091 CTGGGAAAGGCTGTGTGTTCAGG + Intronic
936153172 2:110032723-110032745 GGGGGCAAGGCTGTGCGGTGGGG - Intergenic
936191509 2:110338692-110338714 GGGGGCAAGGCTGTGCGGTGGGG + Intergenic
937412840 2:121691314-121691336 TGGGAATATGCTGTGTGATGTGG - Intergenic
937575460 2:123415559-123415581 ATGGGAAAGCCTGTGTGAAGAGG + Intergenic
938317658 2:130341188-130341210 AGGGGAAAGGCTGTGTTTTGTGG - Intronic
942471753 2:176268119-176268141 AGGGGGAATGCCGTGTGATGTGG + Intergenic
944661224 2:201923542-201923564 CTGGGGAAGGCAGTGGGATGAGG + Intergenic
946308117 2:218867605-218867627 CCAGGAATGGCTGTTTGATGAGG + Intronic
946602871 2:221371325-221371347 CGGAGTAAGGATGTGTGACGTGG - Intergenic
946640895 2:221782557-221782579 CTGGGAAGGGGTGTGTGATGTGG - Intergenic
946788028 2:223268515-223268537 CCTGCAAAGCCTGTGTGATGTGG + Intergenic
947340030 2:229128385-229128407 TAGGGAAAGGCTCTCTGATGTGG + Intronic
948370655 2:237487316-237487338 CGGGGCAAGGCTGGATAATGGGG - Exonic
948469072 2:238165886-238165908 CGGGGAAGGGCTGTGTTTGGAGG - Intronic
948784593 2:240345812-240345834 CGGGAAGCGGCTGCGTGATGAGG - Intergenic
1169423119 20:5475371-5475393 CAGAGAAAGGCTGTGTGCAGAGG + Intergenic
1171012749 20:21517405-21517427 CCGGGAGAGGCTGAGTGCTGTGG - Intergenic
1171318011 20:24212516-24212538 TGCGGACAGGCTATGTGATGGGG - Intergenic
1171862620 20:30414556-30414578 CGGGGAAAGGCTGGGAGTGGTGG - Intergenic
1173123135 20:40312285-40312307 CGTGGAAAGGCTATGAGCTGGGG - Intergenic
1173929307 20:46805480-46805502 AGAGGGAAGGCTGTGTGAAGAGG - Intergenic
1173953432 20:47011492-47011514 TGGGGAGAGGGTGAGTGATGAGG - Intronic
1174036031 20:47668791-47668813 CGGTGACCGCCTGTGTGATGTGG + Intronic
1174735709 20:52963955-52963977 CAGGGAAAGGCTCTGGGAGGAGG - Intergenic
1174858702 20:54070084-54070106 GAGGGATAGGCTGTGTGATTTGG - Intronic
1175360472 20:58406373-58406395 AGGGGAAAGGCTGTGAGACTTGG - Intronic
1175410800 20:58767031-58767053 AGGGGAATGGCTGTGTCATAGGG + Intergenic
1175601003 20:60273090-60273112 TTGAGAAAGGCTGAGTGATGTGG + Intergenic
1178910410 21:36669112-36669134 TTGGGACAGGCTGTGGGATGGGG - Intergenic
1179197133 21:39174880-39174902 CTGGGAAAGTCTGGGTGAAGAGG + Exonic
1182555312 22:31125773-31125795 TGGGGAACGGCTGGGTGATCGGG - Exonic
1183440559 22:37820658-37820680 TGGTGAACGGCTGTGTGATTTGG - Intergenic
1183650486 22:39150851-39150873 CAGGGAAAGCCTCTGTGAGGAGG - Intronic
1184093496 22:42304437-42304459 CGGGGAAAGGCTGGGGGATGTGG - Intronic
1184198877 22:42951438-42951460 CAGGGAGAGGCTGAGTGAGGAGG - Intronic
1185275993 22:49950422-49950444 CTGGGCCAGGCTGTGTTATGGGG + Intergenic
951707200 3:25555287-25555309 CAGGGAAAGCCTCTCTGATGAGG - Intronic
953398546 3:42591640-42591662 GAGGGGAAGCCTGTGTGATGCGG + Intronic
958853492 3:99356667-99356689 TGGGGAAATGCTGTTTGATTAGG + Intergenic
960635597 3:119781595-119781617 GAGGGAAAGGGTGTGAGATGAGG - Intronic
961655187 3:128437926-128437948 AGGGGAAAGGGTGGGTGGTGAGG + Intergenic
961723433 3:128910566-128910588 TGGGGAAAGGCTGTTGGATCAGG + Intronic
962255760 3:133869093-133869115 CTGGGAAAGGCTGTGGGTGGGGG + Intronic
962614794 3:137114368-137114390 GGGGGCAAGGCTGTTTTATGAGG - Intergenic
963626179 3:147676891-147676913 CTGTGAAAGGCTGTGTGGTCAGG - Intergenic
965726568 3:171723136-171723158 CTGGGAAAGGCAGTGTGGAGGGG - Intronic
966925109 3:184639617-184639639 CTGGGAAAGGCAGGGTGAGGGGG + Intronic
967062377 3:185883604-185883626 AGGGGAAATGCTGGGTGATATGG - Intergenic
968470699 4:781198-781220 CCGGGAAAGGCTGTGGCCTGGGG - Intergenic
968599279 4:1501533-1501555 CTGGGAAGGGGTGTGTGCTGGGG + Intergenic
969233816 4:5851262-5851284 CATGGAATGGCTGTGTGATACGG - Intronic
972271013 4:37510914-37510936 AGGGGAATGGCTGTGTGACTTGG - Intronic
976908294 4:90267279-90267301 GGGGGAAAGACTTTGTCATGTGG + Intronic
977473702 4:97475830-97475852 CAGGGAAAGTCTCTGTGAAGAGG - Intronic
979483642 4:121246766-121246788 CGGGGAAGGGGTGTGGGATTTGG + Intergenic
983237119 4:165192269-165192291 TGGGGAGAGGGTGTATGATGTGG + Intronic
983599615 4:169511564-169511586 TTGGGAAAGGCTGGGTGAAGGGG - Intronic
984942272 4:184943283-184943305 CGGAGAATGCCTCTGTGATGTGG - Intergenic
985625017 5:981132-981154 TTGGGAAAGGCTGTGGAATGAGG - Exonic
985891853 5:2722008-2722030 GGGAGGAAGGCTGTGTGTTGTGG - Intergenic
986299409 5:6466359-6466381 AGGGGAGAGGCTGTGGGAGGAGG - Intronic
986755406 5:10831546-10831568 CGGGGAAAGTATGTGTGACCAGG + Intergenic
993049616 5:82911699-82911721 CCAGGAAAGGCAGTGTGACGTGG + Intergenic
996731769 5:126724037-126724059 GGGGGACTGGCTGTGTGATTGGG - Intergenic
997370520 5:133356868-133356890 AGGGAAGGGGCTGTGTGATGTGG - Intronic
997988435 5:138523777-138523799 AGGGGAAAGGCTGGGCGAGGTGG + Intronic
998533266 5:142904643-142904665 TGGGGAAAGGCTCTGTGATGGGG + Intronic
999454713 5:151705604-151705626 CTGGGAAAAGGTATGTGATGGGG + Intergenic
999690647 5:154143272-154143294 CAGGAGAAGGCTGTGGGATGTGG - Intronic
1003286866 6:4742071-4742093 CAGGGAAAGGCTGGGTGTGGTGG + Intronic
1004648378 6:17585121-17585143 AGGTGAAAGGCTGGCTGATGGGG - Intergenic
1008691665 6:53986144-53986166 AGGAGGAAGGCAGTGTGATGTGG - Intronic
1011566300 6:88676868-88676890 AGGGGAATGGCTGGGTCATGTGG - Intronic
1013262625 6:108461254-108461276 GGGGGAAGGGCTCTGTGGTGGGG + Intronic
1017237080 6:152127699-152127721 AGGGGAGAGGCTCTGTGCTGAGG + Intronic
1018390014 6:163335132-163335154 CAGGGAGATGCTGTGTGAAGAGG + Intergenic
1018814216 6:167318704-167318726 GTGGGAAATGCTGTGTGTTGAGG - Intergenic
1018902217 6:168057343-168057365 CGGGGAGAGGCCATGGGATGAGG + Intronic
1019574912 7:1732857-1732879 CGGGGAAAGGCTGTGTGATGAGG + Intronic
1019598455 7:1869279-1869301 CTGGGAGAGGCTGTGGGAGGGGG - Intronic
1020059934 7:5144324-5144346 CGGGGAGGGGCAGTGAGATGAGG + Intergenic
1020168041 7:5823443-5823465 CGAGGAAGGGCAGTGAGATGAGG - Intergenic
1020499797 7:8903283-8903305 AGGGGAAAGGCTTGGGGATGAGG - Intergenic
1023182136 7:37495515-37495537 CGGGGAAAGGGTGGGAGAGGAGG + Intergenic
1023587293 7:41743943-41743965 GGGTGAAAGGCAGTGTGTTGCGG - Intergenic
1024304305 7:47914441-47914463 TTGTGAGAGGCTGTGTGATGAGG + Intronic
1024673762 7:51620025-51620047 CTGGGAAAGGCGGTGGGAGGAGG - Intergenic
1026649741 7:72205488-72205510 TGGGGAAAGGCTGGGTGTGGTGG - Intronic
1027189571 7:75989062-75989084 CGGGGGAAGGCTGGGTGGAGGGG + Intronic
1027624976 7:80533549-80533571 TGGGGAAAAGCTGAGTGTTGGGG - Intronic
1028530278 7:91831052-91831074 AGGGGAGAGGCTGTGAGCTGGGG - Intronic
1029126783 7:98300244-98300266 GGGGGAATGGCTGTGTGTTCTGG - Intronic
1029280703 7:99433577-99433599 CGGGGAAATGGTGTGAGGTGAGG - Intronic
1029408654 7:100393917-100393939 CGGGGATCGGCTGTGTGGAGAGG - Intronic
1029632394 7:101761168-101761190 CGGGGAGAGGCTGGGTGCAGTGG - Intergenic
1030931563 7:115529572-115529594 AGGGGAAAGAATGTGTGATTAGG + Intergenic
1032752424 7:134854789-134854811 CTGGTAAAGGCAGTGTGATATGG + Intronic
1034256866 7:149729464-149729486 TGGGGAAAGGATGAGAGATGGGG - Intronic
1035250050 7:157591136-157591158 TGGGGAAAAGCTGTGTGACAGGG + Intronic
1036008678 8:4695595-4695617 ATGGGGAAGGCTGTGTGGTGGGG - Intronic
1036746752 8:11415356-11415378 CGGGAAGAGGCTGTGAGAAGAGG - Intronic
1036944416 8:13081308-13081330 AGGGGAAAGGCTGGTTGGTGGGG + Intergenic
1037530464 8:19767739-19767761 CAGGAAAAGGCTGGGTGTTGGGG + Intergenic
1037910897 8:22743039-22743061 CGGTGAAGGGCTGTGTGCTGGGG + Intronic
1038199700 8:25400689-25400711 TGGGGAAGGACTGTGGGATGAGG - Intronic
1038791636 8:30673203-30673225 TGGGGAAAGGGTTTGTGTTGTGG + Intergenic
1041279747 8:56198063-56198085 CGGTTAGAGGCTGTGTGATGCGG - Intronic
1042996023 8:74699631-74699653 TGGGGAAAGGCTGGGAGGTGGGG + Intronic
1046258068 8:111727147-111727169 CTGGGACAGGGTGTGTGATAGGG - Intergenic
1047366089 8:124212859-124212881 ACGGGAAAGGATGTGCGATGGGG + Intergenic
1047991452 8:130290824-130290846 AGGGGAAAGTCTGTGTGATACGG - Intronic
1048643937 8:136396495-136396517 CAGGGCAATGCTGTGAGATGTGG - Intergenic
1049022980 8:139970528-139970550 CTGGGACAGGCTGTATGAAGGGG - Intronic
1049306328 8:141906230-141906252 CAGAGAGAGGCTGTGGGATGGGG + Intergenic
1049600036 8:143503506-143503528 CGGGGGATGGCTGGGTGCTGGGG - Intronic
1053753763 9:41281102-41281124 CTGGGAAGGGCTGAGTGGTGGGG - Intergenic
1054332493 9:63774575-63774597 CTGGGAAGGGCTGAGTGGTGGGG + Intergenic
1055938586 9:81626905-81626927 TGGGGAACGGCAGTGTCATGAGG - Intronic
1056806482 9:89732912-89732934 TGGGGAAAGGGTGTATTATGTGG + Intergenic
1057601338 9:96460356-96460378 CAAAGAAAGGCTGTGTGGTGTGG - Intronic
1059419558 9:114182615-114182637 CGGGGCTAGGCTGAGAGATGTGG + Intronic
1061195858 9:129106764-129106786 CTGGGAAATGCTGTGTTATAGGG - Intronic
1061265874 9:129504775-129504797 CAGGGAAAGCCTCTGTGAAGAGG - Intergenic
1061294515 9:129669669-129669691 CGGGGCAAGGCAGGGTGAGGTGG + Intronic
1061884543 9:133585021-133585043 CAGGGACAGGTTGTGAGATGGGG + Intronic
1062282739 9:135759253-135759275 AGGGGCAAGGCTCTGAGATGGGG + Intronic
1202799498 9_KI270719v1_random:162886-162908 CTGGGAAGGGCTGAGTGGTGGGG + Intergenic
1186462903 X:9762825-9762847 CAGGAAAAGGCTGGGTGATCGGG - Intronic
1187735839 X:22302927-22302949 CTGGGAAGGGCAGTGTGAAGAGG + Intergenic
1188202497 X:27308595-27308617 TGGGCAGATGCTGTGTGATGGGG + Intergenic
1196705013 X:118709989-118710011 CAGGGAAGGCCTCTGTGATGAGG - Intergenic
1197803441 X:130376111-130376133 AGGGGAAAGGATGTGGGTTGTGG - Intergenic
1198438590 X:136640159-136640181 CGGGGAAAGGCTGTGGAGAGGGG + Intergenic
1198827411 X:140713817-140713839 GGGGGCAAGTCTGTGTCATGCGG - Intergenic
1199666213 X:150098404-150098426 TGGGGGAAGGGTGTGTGGTGAGG + Intergenic
1199814844 X:151388171-151388193 CAGGTCAAGGCAGTGTGATGTGG + Intergenic