ID: 1019575220

View in Genome Browser
Species Human (GRCh38)
Location 7:1734528-1734550
Sequence ACCAGAGCGGGGAGGGCTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 243
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 221}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019575220_1019575233 -5 Left 1019575220 7:1734528-1734550 CCCTGAGCCCTCCCCGCTCTGGT 0: 1
1: 0
2: 1
3: 20
4: 221
Right 1019575233 7:1734546-1734568 CTGGTCGGGAGGAGGCAGAGGGG No data
1019575220_1019575234 1 Left 1019575220 7:1734528-1734550 CCCTGAGCCCTCCCCGCTCTGGT 0: 1
1: 0
2: 1
3: 20
4: 221
Right 1019575234 7:1734552-1734574 GGGAGGAGGCAGAGGGGACCAGG No data
1019575220_1019575242 30 Left 1019575220 7:1734528-1734550 CCCTGAGCCCTCCCCGCTCTGGT 0: 1
1: 0
2: 1
3: 20
4: 221
Right 1019575242 7:1734581-1734603 CTTCCCGACCTTCCAGGGCCAGG 0: 1
1: 0
2: 2
3: 20
4: 222
1019575220_1019575232 -6 Left 1019575220 7:1734528-1734550 CCCTGAGCCCTCCCCGCTCTGGT 0: 1
1: 0
2: 1
3: 20
4: 221
Right 1019575232 7:1734545-1734567 TCTGGTCGGGAGGAGGCAGAGGG 0: 1
1: 0
2: 3
3: 34
4: 321
1019575220_1019575231 -7 Left 1019575220 7:1734528-1734550 CCCTGAGCCCTCCCCGCTCTGGT 0: 1
1: 0
2: 1
3: 20
4: 221
Right 1019575231 7:1734544-1734566 CTCTGGTCGGGAGGAGGCAGAGG No data
1019575220_1019575237 25 Left 1019575220 7:1734528-1734550 CCCTGAGCCCTCCCCGCTCTGGT 0: 1
1: 0
2: 1
3: 20
4: 221
Right 1019575237 7:1734576-1734598 ACCCCCTTCCCGACCTTCCAGGG No data
1019575220_1019575236 24 Left 1019575220 7:1734528-1734550 CCCTGAGCCCTCCCCGCTCTGGT 0: 1
1: 0
2: 1
3: 20
4: 221
Right 1019575236 7:1734575-1734597 CACCCCCTTCCCGACCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019575220 Original CRISPR ACCAGAGCGGGGAGGGCTCA GGG (reversed) Intronic
900956344 1:5888327-5888349 ACCAGAGCAGAGAGGGCACGGGG - Intronic
900974822 1:6010584-6010606 ACCGGAGCAGGGAGGGGCCAGGG - Intronic
901040498 1:6360340-6360362 GCCTGGGTGGGGAGGGCTCAGGG - Intronic
901514866 1:9738358-9738380 ACCATAGAGGGGAGGGCTGCAGG - Intronic
902382742 1:16060253-16060275 CACAGAGCTCGGAGGGCTCAGGG - Intronic
903271358 1:22190376-22190398 ACCAGAATGGGGAAGGGTCAAGG + Intergenic
903385034 1:22920563-22920585 TCCAGAGCTGGGAGGCCACACGG + Intergenic
903646041 1:24897081-24897103 TCCAGAGCTGGGAGGGGTGAGGG - Intergenic
903768018 1:25747189-25747211 GCCAGTGCAGGGCGGGCTCAAGG - Intronic
904652385 1:32014798-32014820 GCCAGAGCGGGGAGGGACCGTGG + Intronic
904896461 1:33821781-33821803 ACCACAGTGGGGAGGGATGAAGG + Intronic
907946472 1:59140531-59140553 AACAAAGCGGGGAGGGCTCAAGG + Intergenic
911111497 1:94192429-94192451 ACAAAAGCGGGGAGGGGTGATGG + Intronic
911141269 1:94504984-94505006 ACCAGACCAGGGAGGACTCCTGG + Intronic
912510522 1:110186813-110186835 ACAAGAGCTGTGAGAGCTCAAGG + Intronic
912568626 1:110606465-110606487 CCCAGGGCGGGGAGGGGTCTGGG + Intronic
915111224 1:153565715-153565737 ACCAGCTGGGGGAGGGCTCTAGG + Exonic
918215971 1:182392025-182392047 AGCGGAGCCGGGAGGGCTGAGGG + Exonic
920278979 1:204829098-204829120 ACAAGGGCAGGCAGGGCTCACGG - Intronic
920371749 1:205483517-205483539 ACTAGAGGTGGGAGGGGTCAGGG - Intergenic
920377766 1:205518532-205518554 GCAAGGGCGGGGAGGGCTCCAGG + Intronic
920867763 1:209767684-209767706 AAAAGAGGGGGGAGGGTTCAAGG + Intronic
920868761 1:209775567-209775589 ATCAGAGAGGAGAGGGCTCCAGG - Intronic
1064482998 10:15758294-15758316 ACCAGAGCAGGGAGAGGCCAAGG - Intergenic
1067566212 10:47339741-47339763 CTGAGAGCAGGGAGGGCTCAGGG - Intergenic
1069942362 10:71964409-71964431 GCCTGAGCGGGGAGGGCGCCAGG + Exonic
1071222885 10:83490452-83490474 ACCAGAGCAGTGAGAGCTGATGG + Intergenic
1071248547 10:83791422-83791444 ACCAGACCAGGGAGGGAGCAGGG - Intergenic
1073060821 10:100732458-100732480 ACCAGAGAGGGAAGGGTTCAGGG - Intergenic
1073132202 10:101196732-101196754 AACAGAGCAGGGAGGGCTTCTGG - Intergenic
1074224149 10:111467297-111467319 ACCAGAGCTGGGCGGTCCCAGGG + Intergenic
1074535923 10:114328663-114328685 ACCAGAGCAGGGAGAGGCCATGG - Intronic
1076588342 10:131566233-131566255 ACCAGAGGGCGGAGAGGTCAAGG + Intergenic
1076866255 10:133167824-133167846 TCCTGAGCGGAGGGGGCTCAGGG - Intronic
1077302571 11:1854065-1854087 AGAAGAGATGGGAGGGCTCAGGG + Intronic
1078862266 11:15260147-15260169 AACAGAGTGAGCAGGGCTCAGGG - Intergenic
1080610793 11:33901892-33901914 ACCAGAGCAGGGAGGTGTAAAGG + Intergenic
1080927950 11:36777602-36777624 ACCAGAGCTGTCAGAGCTCAAGG - Intergenic
1081776918 11:45681936-45681958 ACAAGAGTAGGGAGGGCTCATGG - Intergenic
1083185250 11:61013912-61013934 ACCATTACGGGGAGGGCTGAGGG - Exonic
1084362011 11:68674899-68674921 ACAAAAGCAGGAAGGGCTCAGGG + Intergenic
1084557886 11:69885706-69885728 GGCAGAGTGGGGAGGGCTGAGGG + Intergenic
1084557904 11:69885748-69885770 GGCAGAGTGGGGAGGGCTGAGGG + Intergenic
1084714653 11:70865977-70865999 ACCAGGGAGGAGAGGGCCCAGGG - Intronic
1085401564 11:76238850-76238872 ACAGGAGCGGGGAGGCCACAGGG + Intergenic
1087290669 11:96316959-96316981 ACCAGAGTGGGGAGGGGGCTTGG - Intronic
1089100697 11:115959726-115959748 ACCAGACAGGGGTGGGCTGAAGG + Intergenic
1095875993 12:47080123-47080145 CGCAGAGCGGGGAGGGGGCAGGG + Intronic
1095955299 12:47802569-47802591 ACCACAGGAGGGAGGGCTGAGGG - Intronic
1095957347 12:47814240-47814262 ACCAGAGAGGACAGGGCTCAAGG - Intronic
1096103884 12:48985674-48985696 ACCAGACGGGGGAGGGGGCAGGG - Intergenic
1096650594 12:53060268-53060290 ACCAGAGTGCGGAGTGCCCAGGG + Intronic
1097033158 12:56104263-56104285 AACAGAGAGGGGCGGGCTGAGGG - Intronic
1097534807 12:60854913-60854935 ATCAGAGCGTGGAGGGCCTAAGG + Intergenic
1100607803 12:96166033-96166055 ACCAGAGCTGTGCGGCCTCAGGG - Intergenic
1102533152 12:113561646-113561668 GCCAGACCGGGGAGGGGTGATGG + Intergenic
1103209520 12:119156464-119156486 ACCAGAGAGAGGAGGGATGAGGG - Intronic
1103827725 12:123753436-123753458 AGCTGAGCAGGGAGGCCTCAGGG - Intronic
1104950723 12:132438745-132438767 AGTAGAGCTGGGAGGGCTCCAGG + Intergenic
1105412292 13:20180694-20180716 ACCTGAGCGGGGGGAGGTCAAGG - Intergenic
1105962640 13:25356039-25356061 ATGAGAACGGGGAGGGCTGAAGG - Intergenic
1106917111 13:34527665-34527687 ACCAGAGCAGGGAGGGGTAAAGG - Intergenic
1113358469 13:109605827-109605849 TCCAGAGAGGGGAGAGCTCGTGG - Intergenic
1113418065 13:110146612-110146634 ACTAGAGCGGGGAGGGAGGACGG + Intergenic
1113567521 13:111327643-111327665 AGCAGGGCGGGGAGAGCTCCTGG - Intronic
1113670423 13:112171959-112171981 GCCAGGGCAGAGAGGGCTCAGGG + Intergenic
1113707813 13:112445641-112445663 ACCAGGGCGGGGAGAGCCCGGGG - Intergenic
1113756664 13:112816580-112816602 ACAAGAGCGTGCTGGGCTCAGGG - Intronic
1114647783 14:24265149-24265171 ACCATAGCTGGGGAGGCTCAAGG - Intergenic
1115783152 14:36793492-36793514 AGCAGAGGGGAGAAGGCTCATGG - Intronic
1118363007 14:65071701-65071723 GCCAGAGCGGGTAGGGCTAGGGG - Intronic
1119754475 14:77105320-77105342 ACCAGAGGGGAGAGGGGACAGGG - Intronic
1121352419 14:93184485-93184507 ACCAGGGCTGGGAGGGGTGAGGG - Intronic
1122940819 14:104980598-104980620 ACCAGAGCAGGGTGGGCTCCTGG - Intergenic
1124248989 15:28095275-28095297 ACCCGGGCGGGGAGTGCGCAGGG - Intronic
1126163499 15:45634874-45634896 ACCAGGGCGTTGAGCGCTCACGG - Exonic
1127712273 15:61611249-61611271 AGGAGAACAGGGAGGGCTCAAGG + Intergenic
1129190641 15:73935580-73935602 GCAAGGGCGGGGAGGGCTCAGGG + Intronic
1129243211 15:74264088-74264110 AAGAGAGTGGGGAGGCCTCATGG + Intronic
1129760689 15:78127701-78127723 ATTAGAGCTGGGAGGGCCCATGG - Intronic
1129880199 15:79001373-79001395 ACCTGTGCTGGGTGGGCTCAAGG + Intronic
1131055299 15:89371330-89371352 ACCAGAGCGCGGAGGGAGCCTGG + Intergenic
1131442682 15:92470851-92470873 GCCAGAGGGAGGAGGGCTCAAGG - Intergenic
1131572544 15:93553732-93553754 ACCAGAGCAGGAAGGGGTTACGG - Intergenic
1132206389 15:99988815-99988837 AGCAGAGGAGGGAAGGCTCATGG + Intronic
1132502397 16:290318-290340 ACCAGGGCAGGAAGGCCTCATGG + Intronic
1133550128 16:6846522-6846544 ACCAGACAGGGGAGGAATCAAGG + Intronic
1133722812 16:8510741-8510763 ACCAGAGTGGGGAGGGATGGAGG - Intergenic
1133906293 16:10025702-10025724 ACCAGAGCGGGGTCCACTCAAGG + Intronic
1134118762 16:11569018-11569040 ACCAGAGAGGGATGGGGTCAGGG - Intronic
1135495637 16:22948931-22948953 ACCAGAGTGGGAAGGGCTTATGG - Intergenic
1138276732 16:55740583-55740605 ATCAGAGGTGGGAGGGCTGATGG - Intergenic
1138286309 16:55812841-55812863 ACCAGAGACAGGAGGGCTGATGG + Intronic
1138392419 16:56679872-56679894 TCCAGAGCTGGAAGGGCCCATGG + Intronic
1140117701 16:72057133-72057155 AGCAGTACAGGGAGGGCTCAGGG - Intronic
1140117918 16:72058857-72058879 AGCAGTACAGGGAGGGCTCAGGG - Intronic
1141622157 16:85242042-85242064 TCCTGAGAGTGGAGGGCTCAGGG - Intergenic
1141783513 16:86181710-86181732 ACCACAGGGGGCGGGGCTCACGG + Intergenic
1142144202 16:88486023-88486045 ACCTGCGCTGGGAGGGCTCGGGG - Exonic
1142252574 16:88999562-88999584 ACCAGAGGGCGGAGGGCGGAGGG + Intergenic
1142718925 17:1763419-1763441 AGCAGGCGGGGGAGGGCTCAGGG - Intronic
1143203698 17:5129241-5129263 TCTAGAGCAGGGAGGTCTCAGGG - Intronic
1143265352 17:5632704-5632726 ACGGCAGCAGGGAGGGCTCAGGG + Intergenic
1143316690 17:6038271-6038293 GCCAGAGCGGGGAGGGCAAAGGG + Intronic
1143524013 17:7462206-7462228 AGACGAGCGGGTAGGGCTCAGGG + Exonic
1144874879 17:18392352-18392374 TCTAGAGCAGGGAGGTCTCAGGG - Intergenic
1145157346 17:20552069-20552091 TCTAGAGCAGGGAGGTCTCAGGG + Intergenic
1145746740 17:27325537-27325559 TCCAGACAGGGGAGGGCCCAGGG - Intergenic
1146054379 17:29573880-29573902 GCGAGAGTGGGGAGGGATCAGGG + Exonic
1146529266 17:33594317-33594339 ACCAGAGCAGGTACGGCTCTGGG + Intronic
1147044425 17:37742823-37742845 GCCAGAGCGGTGAGGCCGCAGGG + Intronic
1147375213 17:40018957-40018979 AGCAGAGGCGGCAGGGCTCAGGG - Intergenic
1147387535 17:40091029-40091051 ACCAGAGGGTGCTGGGCTCAGGG + Intronic
1148894358 17:50831402-50831424 ATCAGAGCGGGAGGGGCTCCTGG + Intergenic
1151190361 17:72393647-72393669 AGCAGAGGTGGGAGGACTCAAGG + Intergenic
1151327083 17:73386131-73386153 AGCAGAGCGGAGGGGGCTCTGGG - Intronic
1151714687 17:75825315-75825337 GCCAGAGAGGGGAGGGGGCAGGG - Exonic
1151930375 17:77228253-77228275 CCCAGAGCAAGGAGGGCTCGGGG + Intergenic
1153473851 18:5475388-5475410 ACCGGACTGGGGAGGGCTAATGG - Intronic
1158587691 18:58755820-58755842 AACAGAGAGTGGAGGGCTGAGGG + Intergenic
1159635806 18:70803542-70803564 AGAAGAGCGGTGAGAGCTCATGG + Intergenic
1160509324 18:79444479-79444501 TCCAGAGCAGCGAGGGCTCGGGG - Intronic
1160538014 18:79605633-79605655 AGCAGAGCAGGGTGGGCTCCGGG - Intergenic
1161332824 19:3696509-3696531 AGCAGGGCAGGGAGGCCTCACGG + Intronic
1161586878 19:5110534-5110556 CCCAGAGCAGGTAGGGCTCACGG - Intronic
1161768010 19:6217419-6217441 CCCAGAGTGGGGAGGGCCCTGGG - Intronic
1162385361 19:10357726-10357748 CCCACTGCGGGGAGGGCCCAAGG + Intronic
1163190482 19:15673415-15673437 GGCAGGGCAGGGAGGGCTCAGGG - Intronic
1163218500 19:15897711-15897733 GGTAGAGCAGGGAGGGCTCAGGG + Intronic
1163374374 19:16921434-16921456 ACCAGGGCAGGGAGGGCCCCTGG - Intronic
1164615297 19:29663999-29664021 AGCAGCGGGGGGAGGGCTGATGG - Intergenic
1165060274 19:33201731-33201753 ACCAGCGTGGGGAAGGGTCAGGG + Intronic
1166124080 19:40703380-40703402 ACCAAGGCGGGGAGAGCCCAGGG - Intronic
1166127647 19:40725309-40725331 AGCAGAGCAGGGTGGGGTCAGGG - Intronic
1167507356 19:49877946-49877968 TCCACAGGGGGCAGGGCTCAAGG - Exonic
1168339984 19:55617152-55617174 AGCAGAGTTGGGAGGGCACAAGG + Exonic
925963025 2:9036149-9036171 ACAAGAGGAGTGAGGGCTCAAGG + Intergenic
926331223 2:11827635-11827657 ACCAGGGCAGGGAGGGATCCCGG - Intergenic
931299712 2:60966301-60966323 TCCATATCGGGGAGGGGTCAGGG + Intronic
932459686 2:71874182-71874204 ACCAGATGGGGAAGGACTCATGG + Intergenic
934576632 2:95405848-95405870 CCCAGAGCGGGGAGGGTGCAGGG - Intronic
934794797 2:97091395-97091417 CCCAGAGCGGGGAGGGTGCAGGG + Intronic
935017568 2:99198582-99198604 ACCACAGGAGGCAGGGCTCATGG + Intronic
935483763 2:103626865-103626887 ACTAGAGTGGGGAGGGAGCAGGG + Intergenic
937933062 2:127220204-127220226 GCCCGAGCGGGGTGGGCTCCTGG - Intergenic
937972902 2:127564319-127564341 CACAGGGCGGGGAGGGCTCCAGG - Intronic
939628759 2:144510359-144510381 ACCAGAGAGGTGAGGGCCCTGGG - Intronic
940353687 2:152717355-152717377 AGCTGAGCGTGGAGGCCTCATGG - Exonic
941916711 2:170818076-170818098 GCCAGCGGGGGGAGGGCGCACGG - Intronic
944873650 2:203939558-203939580 ACCAGATTGGGAAGGGCTGATGG + Intronic
946179713 2:217942159-217942181 AGCAGAGCCAGAAGGGCTCAAGG + Intronic
946199600 2:218064202-218064224 AGCAGAGCCAGAAGGGCTCAAGG + Intronic
946334656 2:219028888-219028910 ACCAGCTCAGGGAGGGATCATGG + Intronic
947762950 2:232617059-232617081 ACCTGAGCTGGGATGGCCCAAGG + Intronic
948011352 2:234651832-234651854 GCCTTAGCGGGGAGGGGTCAAGG + Intergenic
948897650 2:240934759-240934781 GCCACAGTGGGGAGGTCTCAGGG - Intronic
948920299 2:241063227-241063249 ACAAGAGTGTGCAGGGCTCATGG - Intronic
1169142588 20:3234625-3234647 AGAAAAGCGGGGAGGGCTCAGGG + Intronic
1169350139 20:4862123-4862145 ACTACAGCGGGGACAGCTCAAGG + Intronic
1170645112 20:18190940-18190962 GCCAGAGCGGTGAAGGCTGAAGG - Intergenic
1171230260 20:23478870-23478892 ACCAGGTGGGAGAGGGCTCAGGG - Intergenic
1172429174 20:34876190-34876212 ACCAGAGTGGGGTGGGGTCTTGG - Intronic
1172693261 20:36804749-36804771 GACAGAGCGGGCAGAGCTCAAGG - Exonic
1173970195 20:47146696-47146718 ACCAGAGAGAGGCGTGCTCAAGG + Intronic
1175876849 20:62234329-62234351 ACCTGAGTGGGAAGGGCTCTGGG + Intronic
1175889658 20:62310580-62310602 AGCAGACCGGGCAGGGATCAGGG + Intronic
1176181593 20:63752089-63752111 CCCAGAGCGGGGCGGCCCCAAGG - Intronic
1177374999 21:20258555-20258577 TCCTGAGCAGGGAGGGCACAAGG + Intergenic
1178410742 21:32361878-32361900 ACCAGTGCGGTAAGGTCTCAGGG - Exonic
1178895064 21:36551081-36551103 ACCAGAGTGGGGAGGGGGCACGG + Intronic
1181609912 22:24005434-24005456 CCCAGATCGGAGAGGGCACAGGG - Intergenic
1183598355 22:38825719-38825741 TCCATAGCGGGGAGGGCCCGAGG + Intronic
1184296642 22:43529270-43529292 ATCAGAGAGGTGGGGGCTCAAGG + Intronic
1184689418 22:46110665-46110687 ACCACAGCTGGGAGGGTCCAAGG + Intronic
1185409218 22:50673872-50673894 TCCAGACCGGGGAGGGCCCGGGG - Intergenic
949260608 3:2099201-2099223 GCCTGAGCGCGGAGGACTCAGGG + Intronic
950108324 3:10402385-10402407 ACCAGACAGGAGAGGCCTCATGG + Intronic
950193168 3:10992110-10992132 ACTAGAGCAGGGAGGGGGCACGG + Intergenic
950193299 3:10992647-10992669 ACCCGAGCTGGGCGGGCTCCGGG + Intergenic
950437194 3:12987065-12987087 ACCAGATGGGGGACGGCTGAGGG - Intronic
952968609 3:38636781-38636803 GCCAGGGTGAGGAGGGCTCAGGG + Intronic
953548841 3:43884882-43884904 ACCAGAGCGAGGGGGGGGCAGGG - Intergenic
955228340 3:57079004-57079026 CCCAGACCAGGGAGCGCTCAGGG + Intronic
955913126 3:63878842-63878864 CCCAGAGCAGGGAGGGAACAAGG + Intronic
962849987 3:139301204-139301226 ACCAGGGCAGGGAGGGCTCGGGG + Intronic
967811629 3:193765766-193765788 GCCACAGTGAGGAGGGCTCAGGG + Intergenic
967980726 3:195063554-195063576 AGCAGAGAGGTGAGGGCTCCTGG + Intergenic
968234924 3:197025917-197025939 TCCAGAGAGGGAGGGGCTCAGGG + Intronic
968876009 4:3268340-3268362 ACCAGAGCGGAGGGGCCTGAGGG + Intronic
969156617 4:5216691-5216713 AACACAGCGGGGAAGGCTGAAGG + Intronic
969297531 4:6278659-6278681 ACCACAGCAGGGAGGCCCCACGG - Intronic
970594037 4:17583853-17583875 ATCAGAGCAGGGAGGGGTCAGGG - Intronic
971581374 4:28345440-28345462 ACCAGAGAGGGAGAGGCTCATGG + Intergenic
972266549 4:37465479-37465501 CCCAGAGAGGGGAGGGCGAAGGG + Intronic
976105273 4:81610598-81610620 ACCAGAGTGGGGAGAGTGCAAGG + Intronic
978725100 4:111960286-111960308 AACAGAGCTGTGAGGCCTCAAGG + Intergenic
985820129 5:2153997-2154019 ACCACAGCGAGGAGGGCCGAGGG + Intergenic
996331818 5:122337826-122337848 ACCAGAGGAGGCAGGGCGCAGGG - Intronic
997209133 5:132067423-132067445 CACAGGGCAGGGAGGGCTCATGG - Intergenic
997292185 5:132745598-132745620 ACCAGAGCGGGGAGGGAAGGAGG - Intergenic
997469236 5:134107577-134107599 ACCAGGGTGGGGAGGGCACCAGG - Intergenic
999253595 5:150196865-150196887 CCCAGGGAGGGAAGGGCTCAGGG + Intronic
999308306 5:150535042-150535064 GGCAGAGCGGGGCGGGCTAAGGG + Intronic
999626913 5:153530709-153530731 ACCAGAGAGGGCAGCCCTCAAGG - Intronic
1002640467 5:180628318-180628340 CCCAGAGAAGGGAGGCCTCAGGG - Intronic
1003631438 6:7791130-7791152 ACCAGAGGGTGGAGGGGGCATGG + Intronic
1004311895 6:14553374-14553396 ACCAGAGTGGTTAGGGGTCAGGG + Intergenic
1004354639 6:14920435-14920457 ACCAGAGCTGGAAGGGCTGGAGG + Intergenic
1005670781 6:28104568-28104590 ACCTGAGCGGGGAGGACTGACGG + Intergenic
1006129905 6:31862865-31862887 TCCAGACCGGGGCGGGCTTAAGG - Exonic
1009815844 6:68733643-68733665 ACCAGAGCTGGGAAGGCTAGTGG + Intronic
1011626589 6:89288221-89288243 ACCAGAGAGGGGAGGACCAATGG + Intronic
1014227014 6:118860800-118860822 ACCAGAGTGGGGATGGTTTAGGG + Intronic
1017964705 6:159254040-159254062 AACAGTGTGGGGAGGGCTCCAGG + Intronic
1018734897 6:166680423-166680445 ACCAGAGCAGGTAGGTCTCCTGG - Intronic
1019575220 7:1734528-1734550 ACCAGAGCGGGGAGGGCTCAGGG - Intronic
1019576215 7:1738927-1738949 TGCAGAGCAGGGAGGGCTCTTGG + Intronic
1020812614 7:12864724-12864746 ACCACTGCGCGGAGGGCACAGGG - Intergenic
1022562589 7:31365088-31365110 AACAGAGAGGGCAGGGGTCAGGG - Intergenic
1026024148 7:66731875-66731897 AGCAGAGCTGGGAGGATTCAAGG + Intronic
1026888869 7:73970767-73970789 AGCAGAGCTGGGAGGATTCAAGG + Intergenic
1031825777 7:126563590-126563612 AACTGAGAGGGAAGGGCTCAAGG + Intronic
1032015723 7:128379297-128379319 ACCAGAGCCAGGAGGGCTCCTGG - Intergenic
1034937977 7:155211958-155211980 GCCAGGGCAGTGAGGGCTCATGG + Intergenic
1035388661 7:158490615-158490637 ACCAGAACCGGGAGGGCCCCAGG + Intronic
1037816996 8:22117660-22117682 ACCAGAGCAGGGAGCTCTCTGGG + Intronic
1043526883 8:81106708-81106730 AATAGAGGGGGCAGGGCTCAGGG + Intronic
1048295928 8:133213175-133213197 GCCAGAGCTGGGGGTGCTCAGGG - Intronic
1049345366 8:142135883-142135905 TCCAGGGCGGGTAGTGCTCACGG - Intergenic
1049354744 8:142182171-142182193 ACTGGAGCGGGGTGGGCTGAGGG - Intergenic
1049655229 8:143794241-143794263 AAGAGAGCAGGGAGGGCTCGGGG + Intronic
1052716049 9:32118668-32118690 ACCAGAAGCTGGAGGGCTCAGGG - Intergenic
1057209004 9:93189488-93189510 CCCAGAGGGGGCAGGGCTCAAGG + Intronic
1058102546 9:100933271-100933293 ACTAGAGCGGGGAGGGAAGAAGG - Intergenic
1060945578 9:127568169-127568191 ACCAGAGTGGGGGGCCCTCAGGG - Intronic
1061714451 9:132510068-132510090 TCCCAAGCAGGGAGGGCTCAGGG + Intronic
1062101167 9:134729218-134729240 CCCAGAGCGGGGAGGACCCGAGG - Intronic
1062640671 9:137516393-137516415 ACCAGGGCCGGGGGTGCTCATGG - Intronic
1186542203 X:10411971-10411993 ACCTGGGCGGGGAGGGCTGAAGG + Intergenic
1189270893 X:39751160-39751182 ACCTGGGCTGGGAGGGCTAAAGG + Intergenic
1189329438 X:40134247-40134269 ACCAGATCAGAGAGGGGTCAGGG + Intronic
1189417658 X:40829292-40829314 AGAAGAGTGGGGAGGGATCAGGG + Intergenic
1198741132 X:139844318-139844340 AGCAGAGAGTGGAGGGCTCTGGG + Intronic