ID: 1019575557

View in Genome Browser
Species Human (GRCh38)
Location 7:1735944-1735966
Sequence AAGGTCACACAGCAGGCGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 765
Summary {0: 1, 1: 0, 2: 12, 3: 117, 4: 635}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019575557 Original CRISPR AAGGTCACACAGCAGGCGCA CGG Intronic
900474534 1:2869929-2869951 CCGGGCACACAGCAGGCACAAGG - Intergenic
900482609 1:2906469-2906491 AAGGTCACACACCAGGGCCCTGG - Intergenic
900788023 1:4661477-4661499 AAGGTCACACAGCTAGCTCATGG + Intronic
900861545 1:5236378-5236400 AAGCTCACTCAGAAGGCACAAGG + Intergenic
901499251 1:9641464-9641486 AAGGTCACACAGCCGACAGATGG + Intergenic
901768153 1:11516855-11516877 GAGGTCACACAGCCTGCCCAAGG - Intronic
901806466 1:11741643-11741665 AAGGTCACAGAGCAGGCCAGTGG - Intronic
901882319 1:12201514-12201536 AAGGTCACACAGCAAGTGAGTGG + Intronic
901932179 1:12602762-12602784 AAGGTCACACAGCAGGTCACTGG + Intronic
902090700 1:13900709-13900731 AAGGTCACACAGCTAGTGAACGG - Intergenic
902189871 1:14754828-14754850 AAGGTCACACAGCTGGCAGGTGG - Intronic
902532546 1:17099554-17099576 AAGGTCACACAGCAAGTCCTTGG + Intronic
902535275 1:17116162-17116184 AAGGTCACACAGCCCGTGGATGG + Intronic
902538824 1:17137990-17138012 AAGGTCACACAGCCAGCACAAGG + Intergenic
902664345 1:17927149-17927171 AAGGTCACACAGCTGGTACATGG + Intergenic
902696866 1:18146023-18146045 AAGGTCACACAGCAGAGCCAGGG - Intronic
902697008 1:18146879-18146901 AAGGTCACACAGCTGGTTAATGG + Intronic
902786128 1:18733849-18733871 TAGATCTCACAGCAGGCCCAGGG - Intronic
902792902 1:18781207-18781229 AAGATCACACAGCAGGTACAAGG - Intergenic
902889995 1:19435994-19436016 AAGGTCACACAGCTGGGACCCGG - Intronic
903026911 1:20435860-20435882 AAGGTCACACAGCAAGTGAGTGG - Intergenic
903164787 1:21512586-21512608 CAGGTCACACAGCTGGCGATTGG - Intronic
903267441 1:22166313-22166335 AAGGTCACACAGCAGGTGAGTGG + Intergenic
903460043 1:23514447-23514469 AAGGTCACACAGCAAGTTGATGG - Intronic
903668430 1:25021913-25021935 AAGGTCACACAGCAGGCCGGGGG - Intergenic
903734753 1:25523042-25523064 AAGGTCACACAGCTGCTGGATGG - Intergenic
903787434 1:25870611-25870633 AAGATCACACAGCAGGGCAAAGG + Exonic
903860649 1:26362523-26362545 AAGGTCACACAGCAAGTTGAAGG + Intronic
903949943 1:26990836-26990858 AAGTTCACACAGCAGGTAAATGG - Intergenic
903970059 1:27112937-27112959 AAGGTCACACAGCAAGCAAGTGG + Intronic
904039159 1:27574522-27574544 AAGGTCACACAGCCAGCGAGTGG + Intronic
904282250 1:29428852-29428874 AAGGTCACACAACTGGTGCATGG - Intergenic
904282994 1:29434353-29434375 AAGGTCACACAGCTGGTCCATGG + Intergenic
904320463 1:29694845-29694867 AAGGTCACACAGCTGGTGAGAGG - Intergenic
904327174 1:29734344-29734366 AATGTCACACAGCAAGTGAAGGG - Intergenic
904373317 1:30064621-30064643 AAGGTCACACAGCACTTTCATGG - Intergenic
904437267 1:30506927-30506949 AAGGTCACACAGCTGGTGAGAGG + Intergenic
904534533 1:31190469-31190491 AAGGTCACACAGCAGGTTGGTGG + Intronic
904808467 1:33147830-33147852 AAGGTCACACAGCAGGTCAGAGG - Intronic
905104086 1:35552461-35552483 AAGGTCACACAGCAAGAACATGG - Intronic
905256849 1:36690308-36690330 AAGCTCACACAGCTGGCAGATGG - Intergenic
905284765 1:36872049-36872071 AAGGTCACACAGCAGGAAAGTGG + Intronic
905294493 1:36945797-36945819 AAGGTCACACAGCTGATGAATGG + Intronic
905304635 1:37008997-37009019 AAGGTCACACAGCAAGTAAATGG - Intronic
905395952 1:37666681-37666703 GAGGTCACACAGCTGGTACATGG + Intergenic
905397793 1:37678365-37678387 AAGATCACACAGCTGGCTAAAGG + Intergenic
905777341 1:40677353-40677375 AAGGTCACAAAGCAGGTTGATGG + Intergenic
905914815 1:41677410-41677432 AATGTCACACCGCTGGTGCACGG - Intronic
905939833 1:41854247-41854269 AGGGCCACCCAGCAGGCGCTGGG + Intronic
906285595 1:44585723-44585745 AAGGTCACACAGCAGAGCCAAGG - Intronic
906286173 1:44589235-44589257 AAGGTCACACAGCTGGGAAATGG - Intronic
906683239 1:47745135-47745157 AAGGTCACATGGCAAGCCCATGG + Intergenic
906694509 1:47815028-47815050 AAGGTCACACAGCAAGCCAGGGG + Intronic
906929673 1:50156725-50156747 AAGGTCACACAGCAAGCAAGTGG + Intronic
906975881 1:50572646-50572668 AAGGTCACATAGCAGGGCAATGG - Intronic
907251859 1:53144974-53144996 AAGGTCACACAGCTGGTTGAAGG - Intergenic
907284190 1:53369820-53369842 AAGGTCACAGAGCCGACACATGG + Intergenic
907318258 1:53586389-53586411 AAGGTCACAGAGCCAGCCCATGG + Intronic
907460647 1:54603588-54603610 GAGGTCACTCAGCAGGGGTATGG + Intronic
907664815 1:56425431-56425453 AAGGTCAAACAGCTGGCACATGG - Intergenic
908311197 1:62886180-62886202 AAGGTCACACAGCAAGAGAGTGG - Intergenic
910712900 1:90200111-90200133 AAGGTCATACAGCTGCCACATGG + Intergenic
911041836 1:93597489-93597511 GAGGCCACACAGCAGGTGCGTGG - Intronic
911178473 1:94840904-94840926 AAGGGCACGCAGGAGGCTCAAGG + Intronic
912273154 1:108230194-108230216 CAGGGCATACAGCAGGTGCAAGG + Intronic
912295066 1:108464128-108464150 CAGGGCATACAGCAGGTGCAAGG - Intronic
912551173 1:110486372-110486394 AAGGTCACACAGTTAGCACATGG + Intergenic
912952876 1:114132591-114132613 AAGGTCACACAGAAAACACATGG + Intronic
915348421 1:155209576-155209598 AAGGTCACACAGCCAGTGAATGG - Intronic
915482550 1:156196973-156196995 AAGGTCACACAGCTGGTCAATGG - Intronic
915494089 1:156268926-156268948 AAGGTCACACAGCTAACACATGG + Intronic
915728320 1:158034572-158034594 AAGGTCTCACAGCTGGCGAGAGG - Intronic
916018126 1:160768438-160768460 AAGGTCACAATGCAGGCTGATGG + Intergenic
916046251 1:161001968-161001990 AAGATCACACAGCTGGGGCCAGG + Intronic
916205137 1:162308935-162308957 ATGGTCACACAGCTGCTGCATGG + Intronic
916391451 1:164335318-164335340 AAGGTCACACAGCAAGTCAAAGG - Intergenic
916504266 1:165413758-165413780 AAGCCCACACAGCAAGCACATGG - Intronic
916610907 1:166390569-166390591 AATGTCACACAGCACCCTCAGGG - Intergenic
917121230 1:171646222-171646244 AAAGTCACACAGCTGGGACATGG - Intronic
917836080 1:178942567-178942589 CAGGTCACACAGCTGGTGCCTGG + Intergenic
918080411 1:181203564-181203586 AAGGTCTCAAACCAGGTGCAGGG + Intergenic
919980557 1:202640390-202640412 AAGGTCACACAGCAAGTCTAGGG + Intronic
920093846 1:203472980-203473002 AAGGTCACACAGCATGCAATGGG + Intergenic
920253589 1:204638935-204638957 AGGGTCATTCAGCAGGCTCACGG - Intronic
920353804 1:205355731-205355753 AAGGTCACACAGCCAGAACAGGG + Intronic
920676265 1:208040561-208040583 AAGGTCACACAGCCAACGTATGG - Intronic
920803314 1:209209319-209209341 AAGGTCACACAGCAAGTAGACGG + Intergenic
921160791 1:212470839-212470861 AAGGGCACACAGCAAGCTAATGG - Intergenic
922195755 1:223359196-223359218 AAAGTCACACAGCAGGCAGTGGG - Intronic
922553726 1:226517392-226517414 AAGGTCACACAGCTAGTGAATGG + Intergenic
923618001 1:235553791-235553813 AAGGTCACACAGCTAGCTTACGG - Intronic
924207123 1:241725019-241725041 AAAGGCAGACAGCAGGGGCAGGG + Intronic
924368368 1:243320606-243320628 AAGGTCACACAGCCAGTGAATGG - Intronic
924534346 1:244921598-244921620 AAGATCACACAGCTGGCACACGG + Intergenic
1063189753 10:3682274-3682296 CAGGTCACACAGCAGGCAGGCGG + Intergenic
1063609636 10:7551930-7551952 ACTGTCTCACAGCAGGCGCCAGG + Intergenic
1064252713 10:13719054-13719076 AAGGTCACACAGACGCCACATGG + Intronic
1064303690 10:14146045-14146067 AAGGTCACACAGCCAGCGAAGGG - Intronic
1064938565 10:20707413-20707435 AAGGACACAGAGCTGGTGCAGGG + Intergenic
1065485320 10:26231260-26231282 AATGTCACTCAGGAGACGCAGGG + Intronic
1065970146 10:30799559-30799581 AGGGGCACACTGCAGGCACAGGG - Intergenic
1066281932 10:33926226-33926248 AAGGTCACACAGCAAGCTGGTGG - Intergenic
1067053369 10:43037783-43037805 AGGGGCCCACAGCAGGCCCAGGG + Intergenic
1067214240 10:44287606-44287628 TAGGTCACCCACCAGGCTCAGGG + Intergenic
1067468982 10:46522778-46522800 AAGGTTACACAGCTGGCAAAGGG + Intergenic
1067791562 10:49292305-49292327 AAGGTCACACAGCTGGTGTGAGG + Intergenic
1067999417 10:51314169-51314191 AAGGTCACACAGCAACGTCATGG + Intronic
1069039568 10:63681182-63681204 AAGGTCACTCAGCCGGCAGATGG - Intergenic
1069542736 10:69307584-69307606 AAGGTCACACAGCAACTGAATGG - Intronic
1069717383 10:70529845-70529867 AAGGTCACTCAGATGGCTCAGGG - Intronic
1069796008 10:71052441-71052463 AAGGTCACACAGTAGGCTTCTGG - Intergenic
1069865298 10:71498666-71498688 AAAGTCACACAGCTAGCACAAGG - Intronic
1070156420 10:73838357-73838379 AAGGTCACACAGCTGGCAAGTGG - Intronic
1070276681 10:75013821-75013843 GAGGTCACACAGCTGGTACATGG + Intronic
1071347485 10:84706605-84706627 AAGGCCACACAGGAGGCTCCAGG + Intergenic
1071380714 10:85056657-85056679 AAGATCCCACATCAGGCACAAGG + Intergenic
1071512241 10:86269378-86269400 GAGGCCACACAGCAGGAGCTGGG - Intronic
1072236260 10:93456601-93456623 AAGCTCACACAGCAAGCTCGTGG + Intronic
1072538135 10:96378666-96378688 AAGGTCACACAGCTAGGGAACGG + Intronic
1072717897 10:97763528-97763550 GAGGTCACACAGCTTGCACATGG - Intergenic
1072790587 10:98314842-98314864 AAGATTACACAACAGGCCCAAGG - Intergenic
1073072162 10:100801550-100801572 AAGGTCACACAACTGGGGAATGG - Intronic
1073445426 10:103577495-103577517 AAGGTCACACAGCTGGCAGTTGG + Intronic
1074878272 10:117631582-117631604 AAGGCCACACAGCTGGCTTATGG + Intergenic
1075030985 10:119024779-119024801 AAGGACACAAAGCTGGCGCAAGG - Intergenic
1075116264 10:119629652-119629674 AAGATCACACAGCTGGTGAATGG - Intergenic
1075620888 10:123927548-123927570 AAGGTCACACAGCAAATGAATGG + Intronic
1075623358 10:123944130-123944152 GAGGTCACACAGCAGGCAAAAGG - Intergenic
1075684100 10:124352021-124352043 AAGGTCACACAGCATGAAGATGG - Intergenic
1077415483 11:2422566-2422588 CAGGTCACACAGCAGGTCAAGGG - Intronic
1077674015 11:4181746-4181768 AAGATCACACAGCAAGGCCATGG - Intergenic
1077866822 11:6229232-6229254 AAAGTCACACAGCTGGGGAATGG - Intronic
1078222050 11:9359626-9359648 AAGGTTACACACCAGACTCATGG - Intergenic
1078671262 11:13367771-13367793 AAGGTCACACAGCTAGTGAATGG - Intronic
1080328183 11:31102920-31102942 AAAGTCACACAGCTGGTACATGG - Intronic
1080855312 11:36106807-36106829 CAGGTCACACAGCAGAGGGAGGG - Intronic
1080919171 11:36691737-36691759 AAAGTCACACAGCTGGCAAATGG + Intergenic
1081568591 11:44275821-44275843 AAGGTCACACAGCAAGTTAATGG - Intronic
1081593708 11:44444723-44444745 CAGGTCACACAGCTGGTGAATGG - Intergenic
1081606952 11:44533066-44533088 AAGGTCACACAGCACGCTAATGG - Intergenic
1081664561 11:44909305-44909327 AAGGTCACACAGCAAGTTCATGG - Intronic
1081756851 11:45550928-45550950 AAGGTCACACAGCTGGTGCCTGG + Intergenic
1081760544 11:45573870-45573892 AAGGTCACACAGCAGGTGACTGG + Intergenic
1082821001 11:57544588-57544610 AAGGTCACACAGCTGGTACATGG - Intronic
1082989417 11:59194664-59194686 AAGGTCACACAGCAGTCAGATGG + Intronic
1083146446 11:60763351-60763373 AAGGACACACAGCTAGTGCAAGG - Intronic
1083220294 11:61248164-61248186 AAGGTCACACAGCGGGGGAGTGG - Intronic
1083640095 11:64140775-64140797 AAGGTCACAAAGCTGGTACACGG + Intronic
1083882298 11:65554592-65554614 AGGGTCGCACAGCTGGCACATGG - Intronic
1084173736 11:67412767-67412789 AAGGTCACACAGCTGGTGAGAGG - Intronic
1084199163 11:67543761-67543783 AAGGTCACACAGCTGGGTAAAGG - Intergenic
1084313224 11:68328696-68328718 GAGGCCACACAGCAAACGCACGG - Intronic
1084525715 11:69696865-69696887 AAGGTCACACAGCAATCAAAGGG + Intergenic
1084683226 11:70679293-70679315 AAGGTCACACAGCTGGCAAATGG + Intronic
1084717363 11:70882550-70882572 TAGGTCACAGAACAGGAGCAGGG + Intronic
1084951160 11:72666270-72666292 AAGGTCACCCAGCAGGACCCAGG - Intronic
1084970274 11:72767778-72767800 AAGGCCACACAGCTGGGACATGG - Intronic
1085041798 11:73331158-73331180 AAGGTCACACAGCAAGTCCAGGG - Intronic
1085262473 11:75215125-75215147 AAGGTCACACAGCAAGCTTATGG + Intergenic
1085523599 11:77151950-77151972 AAGGTCACACAGCAGATGTGTGG - Intronic
1085651809 11:78274933-78274955 AAGGTCACACAGCTAGAACACGG - Intronic
1085725963 11:78954925-78954947 AAGGTGACACAGCAGGCTAGAGG + Intronic
1086413904 11:86569804-86569826 AAGGTCACACAGCAAGCTGGTGG + Intronic
1086874969 11:92084662-92084684 AATGTCCCACAGCAGGTGAATGG - Intergenic
1087039558 11:93785091-93785113 AAGGTCACACAGCCGGCAAGGGG - Intronic
1087711283 11:101555529-101555551 TAGGTCACACTGCATGCTCAGGG - Intronic
1088250398 11:107857094-107857116 AAGGTCACCCAGCAGAAGGAAGG + Intronic
1088451005 11:109981231-109981253 AAGGTCACACAGCCAGCACATGG + Intergenic
1088753690 11:112867235-112867257 ATGGTCACACAGCAAGTTCATGG - Intergenic
1088846778 11:113674926-113674948 AAGGTCACACAGCTGGTGAGGGG - Intergenic
1088912506 11:114202453-114202475 CAGGTCACACAGAAGGCCCTGGG - Intronic
1089299613 11:117490694-117490716 AAGGTCACACAGCTGGTGAGTGG + Intronic
1089330962 11:117688602-117688624 AAGGTCACACAGCATGTCCTTGG - Intronic
1089344863 11:117784724-117784746 GAGGTCACACAGCAGGTGAGGGG - Intronic
1089349689 11:117815354-117815376 AAGGTCACACAGCAAGCCAAGGG + Intronic
1090529740 11:127578260-127578282 AGGGTCACACAGCAGGTAGAGGG + Intergenic
1090750244 11:129740481-129740503 AATGTCACACAGCTGGCATATGG - Intergenic
1090836237 11:130456061-130456083 AGGGTCACACAGTAAGCCCAAGG - Intronic
1091349843 11:134884351-134884373 AAGGTCACAGAGCTAGTGCAAGG + Intergenic
1091619772 12:2077820-2077842 AAGGTGACACAGCAAGCCCCAGG - Intronic
1093013707 12:14135167-14135189 AAGGTCACACAGCACATGAATGG - Intergenic
1093552545 12:20432135-20432157 AAAGTCACACAGAAGTGGCATGG + Intronic
1095076248 12:37930294-37930316 CAGGTCACACAACAGGAGTATGG - Intergenic
1098486788 12:71030848-71030870 CAGATGACACAGCAGGCACAGGG + Intergenic
1098619008 12:72568478-72568500 AAAATCACACAGAAGGCGCATGG + Intronic
1099006724 12:77242934-77242956 AGGGTCACATAGCTGGTGCATGG - Intergenic
1100226408 12:92561001-92561023 AAGGTCACACAGCAAGCATGTGG - Intergenic
1101658823 12:106748156-106748178 AAGGTCACACAGCTGGCACATGG + Intronic
1101724673 12:107379047-107379069 AAGGTCATTCAGCAGGTACATGG - Intronic
1101791445 12:107931263-107931285 AAGGTTACACTGCTGGCACAGGG - Intergenic
1101814651 12:108136671-108136693 AAAGTCACAGAGCCAGCGCATGG + Intronic
1102204351 12:111079990-111080012 AAGGTCACACAGCAAGCAAGTGG - Intronic
1102219779 12:111186639-111186661 AAGGTCACACAGCTGGCAGATGG - Intronic
1102224163 12:111216256-111216278 AAGGTCACACAGCAAGTGAATGG - Intronic
1102461319 12:113101595-113101617 AAGGTCATTTAGCAAGCGCAGGG + Intronic
1102550039 12:113684987-113685009 AAGGTCACACAGCAAGGGTACGG - Intergenic
1102555626 12:113724787-113724809 AAGGTCACACAGCAGGTCCTTGG + Intergenic
1102678385 12:114673743-114673765 AAGGTCACACAGCGGGTACATGG - Intronic
1102699049 12:114823373-114823395 AAGGTCACACAGCATGAGGTGGG - Intergenic
1102717926 12:114990230-114990252 AAGGTCTCCCTGCAGGAGCAGGG + Intergenic
1102780610 12:115561435-115561457 AAGGCCACACAGCCAGCCCAGGG + Intergenic
1102876636 12:116454282-116454304 AAGGTCACACAGCAAGTGAGCGG + Intergenic
1103123216 12:118398308-118398330 TAGGTCACACAGCCGTTGCAGGG + Intronic
1103231717 12:119336604-119336626 AAAGTCACACAGCTGGTGCGTGG - Intronic
1103402583 12:120653423-120653445 AAGGTCACACAGCAAGCAAGTGG + Intronic
1103530572 12:121598362-121598384 CAGGTCACACAGCTGGTACATGG - Intergenic
1103718484 12:122960367-122960389 AAGGTCACACAGCCAGCGAGTGG - Intronic
1104018688 12:124977215-124977237 GAAGTCACACAGCATGCACAGGG + Intronic
1104048964 12:125183925-125183947 AGAGTCACACAGCTGGGGCATGG + Intergenic
1104412228 12:128568615-128568637 AAGGTCACACAGCTGGCAAGTGG + Intronic
1105798280 13:23879777-23879799 AAGGTCCCACAGCAGTAACAAGG - Intronic
1105826423 13:24127293-24127315 AAGGTCACACAGTACCTGCAAGG - Intronic
1106419047 13:29570371-29570393 AAGTTCACACAGCGAGGGCAGGG - Intronic
1109295009 13:60519726-60519748 AAGGTCACACAACTAGCACAGGG - Intronic
1112381094 13:98891052-98891074 CAGCTCACACCGCAGGCACAGGG - Intronic
1112568504 13:100571669-100571691 AAGGTCACACAGCTGAAACACGG - Intronic
1113347486 13:109494419-109494441 AAGGTCACACAGATGACCCATGG - Intergenic
1113762836 13:112862000-112862022 AAGGTGTCACAGCAGGCGTAAGG + Intronic
1113762840 13:112862038-112862060 AAGGTGTCACAGCAGGCGTAAGG + Intronic
1114672498 14:24418834-24418856 AAAGTCACACAGCAAGTTCATGG + Exonic
1114856713 14:26455391-26455413 AAGGTCACATAGCAGAGCCAGGG - Intronic
1115165223 14:30440509-30440531 AAGGTCACACAGCAAGTGTCAGG - Intergenic
1116951792 14:50885095-50885117 AAGGTCACACAGCAGGTAAGTGG + Intronic
1117224659 14:53642713-53642735 AAGGCCACACAGCAGGAGGTGGG - Intergenic
1117871350 14:60204290-60204312 AAGGTCACACAGCTGGCGTGTGG + Intergenic
1119728583 14:76937171-76937193 AAGGTCACACAGCCAGCAAACGG + Intergenic
1119917885 14:78419153-78419175 AAGGTCACACAGCTAGTTCATGG + Intronic
1120656115 14:87191875-87191897 AAGTGCACACAGCTGGCACATGG + Intergenic
1120720039 14:87880823-87880845 AAGGTAACACAGCAGGAGGGAGG + Intronic
1121021385 14:90582309-90582331 AAGGCCACACATGAGGCGCAGGG - Intronic
1121088345 14:91163719-91163741 AGGGTCACACAGCTGCTGCACGG - Intronic
1121423274 14:93830827-93830849 AAGGCCACACAGCAGGTCAATGG - Intergenic
1121618437 14:95329864-95329886 AAGGTCACACAGCAGGGTGAGGG + Intergenic
1122004771 14:98693106-98693128 AAGGTCACACAGCCAGTGCATGG + Intergenic
1122004906 14:98694843-98694865 AAGGTCACACAGCAAATTCATGG + Intergenic
1122142664 14:99672179-99672201 CAGGCCACACAGTAGGTGCATGG + Intronic
1122201159 14:100123600-100123622 AAGGTAACCCAGCACCCGCAGGG + Exonic
1122856484 14:104562703-104562725 ATGGTCACACAGCAGGCGACAGG + Intronic
1122993078 14:105248037-105248059 AAGGTCACACAGCCGGCGGGTGG - Intronic
1124496249 15:30189212-30189234 AAGGTCACACAGCAAGTCTAGGG + Intergenic
1124747325 15:32349435-32349457 AAGGTCACACAGCAAGTCTAGGG - Intergenic
1125410780 15:39404005-39404027 AAGGTCACACAGCTGCCTAAGGG - Intergenic
1125439314 15:39684917-39684939 AAGGTCACACAGCTAGTCCAGGG + Intronic
1125755676 15:42063058-42063080 AAGGTCACACAGCAAGCCCAGGG - Intergenic
1126908475 15:53392973-53392995 AAGGTCACACAGCCAGTACATGG - Intergenic
1126955067 15:53924301-53924323 AAGGTCACACAGCTGGTAAATGG - Intergenic
1128185159 15:65638427-65638449 AAGGTCACACAGCAAGCTAATGG - Intronic
1128234250 15:66056754-66056776 AAGGTCACACAGCAAGTTCCTGG - Intronic
1128328463 15:66740493-66740515 AAGGTCACACAGCTAGTGAATGG - Intronic
1128329379 15:66745721-66745743 AAGGTCACACAGCAAGCCGGAGG - Intronic
1128349476 15:66879589-66879611 AAAGTCACACAGCAGGGTAATGG - Intergenic
1128367675 15:67015986-67016008 AAGATCACACAGCAAGCGCGTGG - Intergenic
1129324384 15:74792450-74792472 AAGGTCACACAGCAAGTTGATGG + Intronic
1129386936 15:75201590-75201612 GAGGTCAAGCGGCAGGCGCAAGG + Intronic
1129693540 15:77727834-77727856 AAGGTCACACAGCTGGCAGGTGG + Intronic
1130542830 15:84834218-84834240 AGGGTCACACAGCTGGCAAATGG - Intronic
1130885426 15:88088843-88088865 AGGGTCACACAGCTGGAGAACGG - Intronic
1131395563 15:92082883-92082905 AAGGTCACACAGCTTGTACATGG - Intronic
1131717655 15:95130842-95130864 AAGATCACACAGCAAGCGGCAGG - Intergenic
1131770201 15:95728947-95728969 CAGGTCACACGGCAGTAGCAGGG - Intergenic
1131831641 15:96358699-96358721 AGGGTCACACTGCAGGCGCAGGG - Intergenic
1132186196 15:99803989-99804011 AAGGTCACACAGCTGGAGGGTGG + Intergenic
1132392141 15:101446999-101447021 AAGGTGACACAGCAGGAGGCAGG + Intronic
1132429477 15:101748714-101748736 AAGGTCACACAGCTGGAGGGTGG - Intergenic
1132875952 16:2137274-2137296 CAGGTCACACAGCAGGTGGATGG + Intergenic
1132889764 16:2197689-2197711 GAGGTCAGACAGCAGGGACAGGG + Intergenic
1133320465 16:4910436-4910458 AAGGTCACCCAGCAAGGACAAGG + Intronic
1133590989 16:7243290-7243312 AAGGTCACACAGCTGTCACGTGG - Intronic
1133603089 16:7359149-7359171 AAGGTCACACAGCATTTGCACGG - Intronic
1133914226 16:10094306-10094328 AAAGTCACACAGCAGGCGAGTGG - Intronic
1133999580 16:10772264-10772286 AAGGTCACAGAGCTGGAGCGTGG + Intronic
1134122944 16:11597533-11597555 AAGGTCACACAGCCAGCACATGG + Intronic
1134644847 16:15857708-15857730 AAGGTCACGCAGCTGGCGAGTGG - Intergenic
1134673986 16:16076479-16076501 AAGGTCACAGAGAGGGAGCACGG - Intronic
1134686139 16:16159887-16159909 AAGGACACACAGCAGGACCCAGG + Intronic
1135109544 16:19680118-19680140 AAGGTCACACAGTTGGTACATGG - Intronic
1135180695 16:20271723-20271745 AAGGTCACACAGCAAGTCAATGG - Intergenic
1135343112 16:21665504-21665526 ACGATCACACAGCAAGCGAATGG - Intergenic
1135629060 16:24021712-24021734 AAGGTCACAAAGCAAGGACATGG - Intronic
1135737728 16:24945875-24945897 AAGGTCACACAGCAGGGAACTGG - Intronic
1135792474 16:25409908-25409930 AAGGTCACACAGGTGGCAAATGG - Intergenic
1135982505 16:27159240-27159262 AAGGTCACTCAGCCGGTGAACGG - Intergenic
1137306745 16:47208042-47208064 AAGGTAACACAGCAGGAGACTGG + Intronic
1137540874 16:49360752-49360774 GAGGGCACACAGCTGGCACATGG + Intergenic
1137575804 16:49599482-49599504 AAGGTCACACAGCAAGTGAGTGG + Intronic
1137713741 16:50585143-50585165 AAGGTCACAAAGGAGGTGGATGG + Intronic
1138086861 16:54141342-54141364 AAGGTCACACAGCTGGGGAGTGG - Intergenic
1138089842 16:54165139-54165161 AAGGACACACAGGAGGTGGAGGG - Intergenic
1138128501 16:54457970-54457992 AAGGTCACACAGCTAGCACACGG + Intergenic
1138229324 16:55325863-55325885 AAGATCACACAGCAGGTCAAAGG - Intronic
1138417745 16:56880808-56880830 AAGGTCACACAGCTGGCACATGG - Intronic
1138506509 16:57480858-57480880 AAGGTCACACAGCAGGCCTGGGG + Intronic
1138543721 16:57704215-57704237 AAAGTCACACAGCAGGAAAATGG + Intronic
1139321756 16:66120028-66120050 AAGGTCACACTGCAGACGGTAGG + Intergenic
1139332525 16:66204555-66204577 AAGGTGACACAGTAGGGACACGG + Intergenic
1139824355 16:69745388-69745410 AAGGTCACCCAGCTGGTCCATGG + Intronic
1139850542 16:69949526-69949548 AAGGTCACTCAGCGAGTGCATGG - Intergenic
1139879526 16:70172438-70172460 AAGGTCACTCAGCGAGTGCATGG - Intergenic
1140372998 16:74423110-74423132 AAGGTCACTCAGCGAGTGCATGG + Intergenic
1140962499 16:79930057-79930079 AAGCTCACACAGCTGGTACAAGG - Intergenic
1141136563 16:81469315-81469337 AAGGTCACACAGCAGGCAAGTGG - Intronic
1141481385 16:84309009-84309031 AAGGTCACACAGCAAGTGAGTGG + Intronic
1141917157 16:87106973-87106995 TAGGTCACACAGCTAGTGCATGG + Intronic
1142482255 17:226269-226291 CAGGTGACACAGCAGGCGCCAGG + Intronic
1142620597 17:1163217-1163239 TAGGACACACAGCAAGCGCTAGG + Intronic
1142783677 17:2202817-2202839 AAGGTCACACAGCTGGCAAGTGG + Intronic
1142860327 17:2756860-2756882 AAGGTCACCCAACAAGCGCATGG + Intergenic
1143303263 17:5926753-5926775 AAGGTCACACAGCCAGGACATGG + Intronic
1143365622 17:6406664-6406686 AAGGTCACACAGCAGGTCCGTGG - Intronic
1143965554 17:10754338-10754360 AAGGTCACACAGCAAGGACCTGG - Intergenic
1143972851 17:10808047-10808069 AAGGTCACACAGCAAGTGAGTGG - Intergenic
1144269640 17:13603193-13603215 AAGGGCCCACCGCAGGCTCAAGG + Intergenic
1144642981 17:16948963-16948985 AGGGTCACTCAGCTGCCGCAAGG - Exonic
1144761690 17:17710853-17710875 AAGGTCACACAGCAAGTTCATGG + Intronic
1144764903 17:17727308-17727330 AAGGTCACACAGCAGTTGCTGGG + Intronic
1144848151 17:18230712-18230734 AAGGCCACACAGGAGGGGTAGGG - Intronic
1146488665 17:33263997-33264019 AAGGTCACACAGCTGGCAGGAGG - Intronic
1146662761 17:34675533-34675555 AAGATCACACAGCAGGTATAGGG + Intergenic
1146787737 17:35733371-35733393 AAGGTCACACTTCAGGTGAATGG + Intronic
1147028793 17:37612847-37612869 AAAGTCACACAGCTGGCAAATGG + Exonic
1148048304 17:44757477-44757499 AAAGTCACACAGCTGGTGAAAGG - Intergenic
1148204885 17:45774061-45774083 AAGGCCACACAGCAAGGGGATGG + Intergenic
1148212965 17:45819329-45819351 AAGGTCACACAGCTAGTGGAAGG + Intronic
1148228592 17:45916832-45916854 AGAGTCACACAGCAGGTTCATGG + Intronic
1148344915 17:46896839-46896861 AAAGTCACACAGCATGGGCCTGG + Intergenic
1148358607 17:46993902-46993924 AAGGTCACACAGCTGGTCCATGG + Intronic
1148397211 17:47318669-47318691 AATGTAAAACAGCAGGGGCAGGG + Intronic
1148431735 17:47649148-47649170 AAGGTCACACAGCTGGTTAATGG - Intergenic
1148699685 17:49580043-49580065 AGGGACACACAGCACGCGGATGG - Exonic
1149043016 17:52212414-52212436 AGGGTCACACAGAAAGGGCAAGG + Intergenic
1149875929 17:60233064-60233086 AAGGTCATAAAGCAAGTGCAAGG + Intronic
1150352930 17:64459627-64459649 AAGGTCACACAGCCAGTGAATGG - Intronic
1150788004 17:68178232-68178254 AAGGTCACACAGCTGGTCCATGG - Intergenic
1150890526 17:69144053-69144075 AAGGTCACACAGCTAGTACATGG - Intergenic
1151345493 17:73498917-73498939 AAGGTCACACAGCCAGTACACGG - Intronic
1151705369 17:75764503-75764525 GAGGTCACACAGCAGGTTCTTGG - Intronic
1152035851 17:77872327-77872349 AAGGTCACCGAGCAGACCCAAGG - Intergenic
1152056842 17:78035302-78035324 AAGGTCACACAGGAGGTGGTGGG - Intronic
1152383308 17:79953540-79953562 AAGGTCACACAGCTGGCAAGTGG + Intronic
1152472490 17:80498211-80498233 AAGGACCCACAGCAGGCGACCGG - Intergenic
1153166701 18:2269739-2269761 CAAGTCACACAGCTGGTGCATGG + Intergenic
1153265229 18:3262546-3262568 GAGGTCACCCAGGTGGCGCAGGG - Exonic
1153275202 18:3360979-3361001 AAGGTTCCACAGCTGGCTCATGG - Intergenic
1154005092 18:10520712-10520734 AAGGTCACACAGCAAGTAAACGG - Intergenic
1154259481 18:12817702-12817724 AAGGTCACACAGCTGGAACATGG + Intronic
1154316185 18:13304847-13304869 AAGATGACACAGCAGACGGAAGG + Intronic
1154325914 18:13390304-13390326 AAGGACACATAGCAGGAGCACGG - Intronic
1155131075 18:22934824-22934846 AAGGTCACACAGCTGGGACATGG - Intronic
1156571338 18:38256977-38256999 AGGGTCACACAGCAGGTATAAGG - Intergenic
1156889905 18:42178736-42178758 AAGGTCACACAGCTGGTGGCAGG + Intergenic
1157284573 18:46368767-46368789 AAGGTCCCACAGCAAGTGAATGG - Intronic
1157314205 18:46574832-46574854 AAAGTCACACAGCAGGTGGACGG + Intronic
1157543967 18:48534911-48534933 AACGTCACACAGCAGGAGAGGGG + Intergenic
1157747191 18:50146284-50146306 AAGGTCACACAGCCCGTGAATGG + Intronic
1157894251 18:51448925-51448947 AAGGCCACACACCAAGAGCAAGG + Intergenic
1158366970 18:56747244-56747266 AAGGTCACACAGCAAGTCAATGG - Intronic
1158588846 18:58762930-58762952 AAGGTCACACTGGAGTCGCGGGG + Intergenic
1158795469 18:60840364-60840386 GAGGACACAAAGCAGGCTCAGGG + Intergenic
1159794152 18:72821754-72821776 AAGGTCACACAGCAAGCAGGTGG + Intronic
1160604216 18:80037253-80037275 CAAGTCACACAGCAGGGGCTGGG - Intronic
1160785021 19:896356-896378 AAGGTCACACGGCAGGCATGTGG + Intergenic
1160814132 19:1027597-1027619 AGGGTCACACAGCAGGGTCCTGG + Intronic
1160876203 19:1297226-1297248 AATTTCACACAGCAGGAGCTGGG - Intronic
1161153244 19:2720482-2720504 AAGGTCACAGAGCAGGGGGGTGG + Intronic
1161485901 19:4535503-4535525 AAGGTCACTCAGCAGGGCTATGG - Intronic
1161582955 19:5090748-5090770 AAGGTCACACAGCAGGAGGCTGG + Intronic
1161606710 19:5219140-5219162 AAGGTCACACAGCATGGGAATGG - Intronic
1162001670 19:7748129-7748151 AAGGTCACACAGCTGGTAGATGG + Intergenic
1162003408 19:7762633-7762655 AAGGTCACACAGCTGGTAAATGG - Intergenic
1162015733 19:7845608-7845630 AAGGTCACACAGCTGGTTGAGGG + Intronic
1162305312 19:9869419-9869441 GAGGTCACACAGCAAGCGAATGG - Intronic
1162322914 19:9980290-9980312 AAGGTCACACAGTAGGTGAGTGG + Intronic
1162830967 19:13284139-13284161 AAGGTCACACAGCAAGCCAGTGG - Intronic
1162942851 19:14024045-14024067 AAGGTCACACAGCAGGAAAGAGG + Intergenic
1163530051 19:17843607-17843629 AAGGTCACACAGCAAGTTAAAGG - Intronic
1163641958 19:18467040-18467062 AAGGCCACACAGCAGGGCCGGGG - Intronic
1163706325 19:18815795-18815817 GAGGTCACACAGCAAGCAGATGG + Intergenic
1164791591 19:30989991-30990013 GAGGTCACACAGCAAGATCATGG + Intergenic
1164910554 19:32007934-32007956 AGGGTCACAGAGCAAGGGCATGG - Intergenic
1165059001 19:33195703-33195725 AGGCTCACACAGCTGGGGCAAGG - Intronic
1165148798 19:33749273-33749295 AAGGTCACACAGCTGGCCAGTGG - Intronic
1165312733 19:35038809-35038831 AAGGTCACACAGCTGGCCAGTGG + Intronic
1165744402 19:38222302-38222324 TAGGACACACAGCAGGCGCTGGG + Intronic
1165941976 19:39419160-39419182 AAGGTCACAAAGCAGGGACATGG - Intronic
1166049071 19:40247415-40247437 AAGGTCACACAGCAGGGATGTGG + Intronic
1166165143 19:40982476-40982498 AATGTCACGCAGCAGGCTAAAGG - Intergenic
1166326304 19:42053199-42053221 AGGGTCACACAGCAAGCACCCGG - Intronic
1166695293 19:44848380-44848402 AAGGTCTCACAGCAGGTCCCGGG + Intronic
1166705236 19:44904780-44904802 AAGGTCACACAGCTGGCAACTGG + Intergenic
1166951528 19:46431596-46431618 AAGGTCACACAGCTAGTGAATGG + Intergenic
1167849605 19:52191251-52191273 AAGGTCACACAGCAGGTGGGAGG - Intronic
924982635 2:236533-236555 AAGGTCGCACAGCATGCAAAAGG - Intronic
925131826 2:1499221-1499243 AAGGTCAGAGGGCAGGCGGAAGG - Intronic
925177141 2:1793761-1793783 AAGGTCACCCAGGACGTGCATGG - Intronic
925585577 2:5461072-5461094 AGGCTCACACAGGAGGCCCATGG - Intergenic
926175055 2:10583493-10583515 AATGTGACACAGAAGACGCATGG + Intronic
926212480 2:10880949-10880971 AAGGTCACACGGCAGGTCCATGG - Intergenic
926249518 2:11146283-11146305 AAGGTCACACAGCTGGCAAGTGG + Intronic
926559547 2:14401232-14401254 AAGGTCACACAGCATGCTACTGG - Intergenic
926672652 2:15590513-15590535 AAGGTCACACAGCAAGCAAGTGG + Intergenic
927810815 2:26179373-26179395 AAGGTCACACAGCTGGCTAGTGG + Intronic
928317267 2:30255905-30255927 AAGGTCACACAGCTTGTTCATGG - Intronic
928366570 2:30707505-30707527 AAGGTCACACAGCAAGTCAATGG + Intergenic
929279780 2:40065211-40065233 CAGGTCACACAGCAGATGAATGG + Intergenic
929696059 2:44116429-44116451 AAAGTCACACAGCTAGCGCTTGG - Intergenic
929986555 2:46739596-46739618 AAGGGCACACAGCAGGCTTCTGG - Intronic
930090921 2:47530891-47530913 AAGATCACAAAGCAAGCACATGG + Intronic
930103527 2:47620919-47620941 AAGGTCACACAGCTGGTGATGGG + Intergenic
930301922 2:49627447-49627469 AAGGTCACACATCAGACTCAAGG - Intergenic
931588420 2:63854141-63854163 AAGGTCACAGAGCAGGCCAATGG - Intronic
931668761 2:64628200-64628222 AAGGTCACACAGCTGGCAAGTGG - Intergenic
932842413 2:75095814-75095836 AAGGGCACACAGAAGGGACAGGG - Intronic
932859616 2:75276277-75276299 AAGGTCACACAGCTAGTGCATGG + Intergenic
933307331 2:80618647-80618669 AAGGTCACACAGCAGGGCGATGG + Intronic
933804405 2:85987683-85987705 AAAGTCACACAGCTGGAGCCAGG - Intergenic
933813579 2:86048466-86048488 AAGGTCACACAGCAAGTTCAAGG + Intronic
934477112 2:94601169-94601191 AAGGTCACACAGCCTGTACATGG - Intronic
934573782 2:95388041-95388063 AAGGTCACACAGCTGGTGAATGG - Intergenic
935671985 2:105563689-105563711 AAGGTCACACCGCAGGTTGATGG - Intergenic
936029409 2:109059277-109059299 AAGGTCACACAGCATGGGGCTGG + Intergenic
936475372 2:112835055-112835077 AAGGTCAAACAGCAAGTGAATGG + Intronic
936508382 2:113126342-113126364 AAGGTCACACAGCTTGCTGATGG - Intronic
936508444 2:113126790-113126812 AAGGTCACACGGGTGGCACAAGG + Intronic
936623987 2:114128353-114128375 GAGGTCACAAAACAGGCCCAGGG - Intergenic
936628407 2:114173901-114173923 AAGGTCACACAGCTAGCAAAGGG - Intergenic
937094994 2:119229562-119229584 AACGTCACACAGCTAGCACATGG + Intronic
938717043 2:134030234-134030256 AAGGTCATACAGCAAGGTCATGG - Intergenic
939332507 2:140782921-140782943 AAGGTCACACAGCAGGAGTATGG + Intronic
940127438 2:150342783-150342805 AAGGTCACACAGCCAGCACATGG + Intergenic
941284518 2:163592917-163592939 AAGGTCACACAGCTTGTCCATGG + Intergenic
945212009 2:207393366-207393388 AAGGTCACACAGCTGACAAATGG + Intergenic
945265937 2:207891449-207891471 AAGGTCACACAGCAGGTAAGGGG + Intronic
946403008 2:219478446-219478468 AAGGTCACAGAGCTAGCACATGG + Intronic
946407056 2:219497361-219497383 AAGGTCACACAGCAAGCCAGAGG + Intronic
946469635 2:219946641-219946663 GAGGTCACATAGCAGGTGGATGG - Intergenic
946825956 2:223678159-223678181 AAGATCACACAGCAAGCAAATGG + Intergenic
948329506 2:237154016-237154038 AAGGTCACACAGCAGAGGGAAGG - Intergenic
1168805670 20:671026-671048 AAGGCCACACAGAAGGCTAATGG + Intronic
1168816169 20:738841-738863 TAGGTCACACAGCAAGTCCATGG - Intergenic
1168982876 20:2022871-2022893 AAGGTCACACAGCAAGTACATGG - Intergenic
1169248438 20:4042178-4042200 AAGGTCACACAGCTGGCAAGCGG - Intergenic
1169426344 20:5500396-5500418 AAGATCACACAGCCAGCCCAAGG + Intergenic
1169477486 20:5945339-5945361 AAGGTCCCACAGCAGGCTTTTGG + Intronic
1170412561 20:16107071-16107093 AAGGTCACCCAGCAAGGGAAGGG + Intergenic
1171048836 20:21836956-21836978 AAGGTCACACAGCAGAAAAAAGG - Intergenic
1171062694 20:21981804-21981826 AAGGTCACACAGCAAATCCAGGG + Intergenic
1171122262 20:22577769-22577791 AAAGTCAGAAAGCAGACGCAGGG - Intergenic
1171961214 20:31496229-31496251 AAGGTCACAGAGCTGGCAAATGG - Intergenic
1172014444 20:31864594-31864616 AAGGTCACACAGCAAGTAAATGG + Intronic
1172037480 20:32019865-32019887 AAGGTCACACAGGAAGCACGTGG + Intronic
1172037758 20:32021764-32021786 AGGCTCACACAGCAGGTTCATGG - Intronic
1172121219 20:32599924-32599946 AAGGTCACACAGCTGGTGAGTGG - Intronic
1172185286 20:33027625-33027647 AAGGTCATACAGCAAGTGAATGG - Intergenic
1172293484 20:33792074-33792096 AAGGTCACACAGCAAGTGCATGG - Exonic
1172357951 20:34292698-34292720 AAGGTCACACAGCTGGCAAGTGG - Intronic
1172636649 20:36414562-36414584 AAGGTCACACAGCAGGTGGAGGG - Intronic
1172799700 20:37567213-37567235 AAGGTCACACAGCTTGCACATGG + Intergenic
1172897438 20:38310325-38310347 AAGATCACATAGCAGCCGAATGG - Intronic
1172977743 20:38919364-38919386 ATGGTCACACAGCTGGCTCCTGG - Exonic
1173222921 20:41144216-41144238 AAGGTCACATAGCAAGTTCATGG + Intronic
1173260176 20:41427508-41427530 AAGGTCACACAGCTGGCAAGTGG + Intronic
1173456757 20:43208800-43208822 AAGGTCACACAGCCAGGGAATGG - Intergenic
1173609643 20:44357219-44357241 AAGGTCACACAGCTGGTGTGTGG - Intronic
1173617780 20:44414135-44414157 AAGGTCACTCAGCAAGGGAAGGG - Intronic
1173662970 20:44746544-44746566 AAGGTCACACAGCAAGTGTGAGG - Intronic
1173667111 20:44771032-44771054 AAGGTCACACAGCAGGAAGGGGG + Intronic
1173906793 20:46635286-46635308 AAGCACACACGGCAGGCCCAGGG + Intronic
1173940458 20:46906712-46906734 AAGGTCACCCAGCAAGTGCAGGG + Intronic
1173943976 20:46935312-46935334 CAGGTCACACAGCCAGTGCATGG - Intronic
1174103816 20:48147915-48147937 AAGGTCACACAGCCAGCAAATGG - Intergenic
1174121517 20:48269278-48269300 AAGGTCACACAGCTGGCACAGGG - Intergenic
1174126453 20:48310487-48310509 AAGGTCGCACAGCTGGAGAACGG - Intergenic
1174568589 20:51484815-51484837 TGGGTCAGAAAGCAGGCGCAGGG - Intronic
1174596448 20:51688041-51688063 GAGGTCACACAGCAGGTGAAAGG - Intronic
1174799536 20:53551637-53551659 AAGGTTATAAAGCTGGCGCATGG - Intergenic
1175137018 20:56831904-56831926 AAAGTCATACAGCAGGCAAATGG + Intergenic
1175159077 20:56994637-56994659 AAGGTCACACAGCTGGAAAAAGG - Intergenic
1175206435 20:57315284-57315306 AAGGTCACACAGCAAGTGAGTGG - Intergenic
1175248716 20:57596540-57596562 AAGGTCACACAGCCAGTGAATGG - Intergenic
1175308761 20:57996390-57996412 AAGGTCACACAGCAAGCAAGTGG + Intergenic
1175538434 20:59732282-59732304 AAGGTCACACAGCTGGTAAATGG - Intronic
1176056667 20:63152581-63152603 AAGGTCACACAGCAGGTGTGTGG + Intergenic
1178227575 21:30740954-30740976 AAAGTCACACAGCAGGAGTGGGG + Intergenic
1178499011 21:33110459-33110481 AGGGTCACACAGCAAGGGCTGGG - Intergenic
1178723838 21:35034133-35034155 AAGGTCACACAGCTGGGAAATGG - Intronic
1181573051 22:23778231-23778253 AAAGTCACCCAGCAAGGGCATGG - Intronic
1181951331 22:26555908-26555930 ACACTCACACAGCAGGTGCAGGG + Intronic
1181951901 22:26560129-26560151 AAGGTCACACAGCAAGTTAATGG + Intronic
1182118268 22:27770475-27770497 AAAGTCACACAGCTGGGACAAGG - Intronic
1182761980 22:32729803-32729825 AAGGTCACCCAGCAAGTGAATGG - Intronic
1183014116 22:34971915-34971937 CAGGTCACACAGCTGGCTCATGG - Intergenic
1183020055 22:35019554-35019576 CAGGTCACACAGCAGGGCCAGGG + Intergenic
1183225296 22:36545806-36545828 AAGGTCACACAGCTTGAGTATGG + Intergenic
1183345429 22:37304773-37304795 AAGGTCACCTAGCAGGCAAACGG - Intronic
1183377202 22:37472264-37472286 AAGGTCACACAGCAAGCCAGTGG + Intronic
1183423805 22:37726611-37726633 AAGGTCACACAGCCGGTAAATGG - Intronic
1183457321 22:37929944-37929966 AAGGACACACAGCAGGTGGGAGG - Intronic
1183468870 22:37995082-37995104 AAGATCACACAGCAGGAGCTGGG - Intronic
1183661317 22:39223173-39223195 AAGGCCACACAGCTGGCTAAGGG + Intergenic
1183732293 22:39625437-39625459 CAGGTCACACAGCAGGCATATGG - Intronic
1184200033 22:42962403-42962425 AGTGTCCCACAGCTGGCGCAAGG + Intronic
1184404188 22:44290885-44290907 AAGGTCACACAGCAGGATTGAGG + Intronic
1184601812 22:45548416-45548438 AGGGTCACACAGCAAGTTCATGG - Intronic
1185100696 22:48839391-48839413 GAGGGCACAGAGCAGGCGCTGGG + Intronic
1185231805 22:49687940-49687962 AAGGTCACACAGCAGGGCTGGGG + Intergenic
949535645 3:4994478-4994500 AAGGTCACACAGCAAGCAGATGG + Intergenic
949887920 3:8711142-8711164 AAAGTCACACAGCTTGCACATGG - Intronic
950108908 3:10405944-10405966 TAGGTCACACAGCATGTTCATGG - Intronic
950124448 3:10502904-10502926 AAGGTCACACAGCTGGCATGTGG - Intronic
950131361 3:10549096-10549118 CATGTCACACAGCTGGCACATGG - Intronic
950138377 3:10599170-10599192 AAGGTTATTCAGCAGGGGCAGGG - Intronic
950153554 3:10706915-10706937 AAGGTCACACAGCAGGGGGCAGG - Intronic
950454269 3:13083415-13083437 AGGGTCACACAGCAGGTGAGTGG - Intergenic
950525521 3:13520685-13520707 AGGGCCACACAGCATGTGCAGGG - Intergenic
950529959 3:13547752-13547774 AAGGTCACACAGCTGGTGTGTGG + Intergenic
950671850 3:14532100-14532122 AAGTTCCCACAGCTGGCGAATGG - Intronic
950686692 3:14623410-14623432 AAGGTCACACAGCAAGCTGGTGG + Intergenic
950956100 3:17054883-17054905 AAAGTCACACAGCAGGGACATGG - Intronic
951655542 3:25003793-25003815 AAGGTCACAGAAAAGGCTCATGG + Intergenic
951834359 3:26964661-26964683 AAGGTCACACAGCAAGTAAATGG + Intergenic
953088273 3:39695987-39696009 AAGGTCACATAGCAAGCGGTGGG - Intergenic
953261181 3:41340413-41340435 AAGGTCACATAGCCAGTGCATGG - Intronic
953419770 3:42745401-42745423 AAGGTCACACAGCTGGTGAGTGG + Intronic
953591945 3:44266052-44266074 AAGGTCAAACAGGAAGTGCAAGG - Intronic
953744091 3:45560031-45560053 GAGGTCACAGAGCCGGCGTAGGG - Intronic
954442393 3:50528834-50528856 GAGGTCACACAGCTGGAGCTTGG - Intergenic
954456512 3:50602591-50602613 GAGGAGACACAGCAGGCCCAGGG - Intergenic
954917784 3:54163726-54163748 AATGTCACACTGCAGCTGCAAGG + Intronic
955402630 3:58604050-58604072 AAGCTCAGAGAGCAGGCGGAGGG - Intronic
955403722 3:58611704-58611726 AAGGCCACACAGCAGGTCAATGG - Intronic
955829468 3:62985890-62985912 TAGGTCACACAGCAGGTACTTGG + Intergenic
955938991 3:64130070-64130092 AAGGTCACACAGCTAGTGAATGG - Intronic
956611266 3:71125883-71125905 CAGGTCACACAGCTAGCGAATGG - Intronic
956856129 3:73276573-73276595 AAGGTCACACAGCTGGAAAACGG + Intergenic
957118947 3:76063721-76063743 AAGGTCACTCAGCAGACTTATGG + Intronic
959516551 3:107273543-107273565 AAGGTCACTCAGTAGATGCAAGG + Intergenic
960166995 3:114413824-114413846 AAGGTCACACAGCTGGTAAATGG + Intronic
960962056 3:123078307-123078329 AAGGGCACAGAGCAAGCGCTGGG + Intronic
961538922 3:127587521-127587543 CAGGTCACACAGCAAGCACGTGG - Intronic
961607027 3:128103629-128103651 AAGGTCACACAGCAAGCTGGTGG + Intronic
962317596 3:134368493-134368515 AAGGTTAAACAGCTGGAGCAGGG - Intronic
962562395 3:136620486-136620508 AAGGTCACACAGCAAGTAAATGG - Intronic
963116375 3:141733516-141733538 CAGGTCACACAGCAAGCAAAGGG - Intergenic
963254261 3:143129357-143129379 AAGGTCACACAGCTAGTGCATGG + Intergenic
964201060 3:154120187-154120209 ATTGTCACACAGCAGGAGCCTGG + Intergenic
964223175 3:154368976-154368998 ATGGGCGCACAGCAGGGGCAAGG + Intronic
964669184 3:159206501-159206523 AGGGTCACACAGCAAGATCAAGG - Intronic
964691502 3:159454785-159454807 AAGGTCACACAGCAATCTGAAGG + Intronic
964756103 3:160092094-160092116 AAGGTCAGACAGCAAGGGCAGGG - Intergenic
965439867 3:168699426-168699448 AAAGTCACAGGGCAGGCACAGGG - Intergenic
965572924 3:170189650-170189672 GAGGTCACAGAGCTGGTGCATGG - Intergenic
966863549 3:184243805-184243827 GAGGGCAAACAGCAGGAGCAGGG + Exonic
967169806 3:186814164-186814186 AAGGTCATACAGAAGACTCATGG + Intergenic
967493885 3:190121700-190121722 AAGGTCACACAGCTGGTAAACGG - Intronic
967866946 3:194198125-194198147 GAGGCCACACAGCAGGAGCTTGG - Intergenic
968627252 4:1631515-1631537 AAGGGCACACAGCAGTCCCAGGG + Intronic
969093224 4:4712518-4712540 CAGGACATACAGCAGGAGCAAGG + Intergenic
969101259 4:4769900-4769922 AAGGGCACACAGCTGGTACATGG - Intergenic
969200814 4:5604012-5604034 AAGGTCACAAAGCTGGTACATGG - Intronic
969201120 4:5606913-5606935 AAGGTCACACAGCTAGAACATGG + Intronic
969377224 4:6770905-6770927 AAGGTCACACAGCTGGCTGGTGG - Intergenic
969569518 4:8000441-8000463 AAGGTCACACAGCAAGGGACGGG + Intronic
969569528 4:8000508-8000530 AAGGTCACACAGCAAGTGACGGG + Intronic
969629810 4:8329567-8329589 AAGGTCTCACAGCTGGAGGAGGG - Intergenic
970157994 4:13160680-13160702 AAGGTCTCACAGAAAGCTCAAGG + Intergenic
971363010 4:25954029-25954051 AAGGTTACTCAGCAGGCAAAGGG - Intergenic
973741709 4:53925173-53925195 AAGGCCACACAGCAAGTGAAGGG - Intronic
974875434 4:67698547-67698569 AAAGTCACAGAGCAGGCAAATGG + Intronic
974968892 4:68801796-68801818 ATGGGCGCACAGCAGGGGCAAGG + Intergenic
975492581 4:75004930-75004952 AAGGTCACACTGCTAGCACACGG - Intronic
975537725 4:75469668-75469690 AAGGTCACACAGCAAGTAAATGG + Intergenic
975847130 4:78536486-78536508 AAGGTCACAAAGCAAGCAAACGG - Intronic
975870525 4:78775369-78775391 AAGGTCACACAGCTGGCTCGTGG - Intergenic
975987365 4:80213796-80213818 AAGGTTACACAGCTGGAGAATGG - Intergenic
976654107 4:87469379-87469401 AAAGTCACACAGCTAGCACATGG + Intergenic
977664651 4:99631997-99632019 AATGTCTCACAGCTGGCGAAAGG + Intergenic
978381600 4:108134783-108134805 AAGGTCACATAGCAAGCCAAAGG + Intronic
978577808 4:110203434-110203456 AATCCCACACAGCAGGCGCCAGG - Intergenic
979303106 4:119110092-119110114 AAGGTCACACAGCAAGGAGAGGG - Intergenic
981634298 4:146858244-146858266 AAGGTCACACAGCTAGTGCATGG + Intronic
982217722 4:153096561-153096583 AAGGTCACACAGCTAGCAAATGG + Intergenic
983948195 4:173609603-173609625 AAGGTCAAACAGCAGAAACACGG - Intergenic
983967580 4:173831819-173831841 CAGGTCACAGAGCAAGAGCAGGG + Intergenic
985105878 4:186499823-186499845 AAGGTCACACAGCTAGTGAATGG + Intronic
985495699 5:203849-203871 GAATTCACACAGCAGGCCCAAGG + Exonic
988615201 5:32768570-32768592 AGGGTCACACAGCTGGCACACGG - Intronic
992562205 5:77963965-77963987 AAGGTCACACAGCAAGCAAACGG - Intergenic
993615645 5:90108614-90108636 AAGGTAACACAGCTGTTGCATGG + Intergenic
995371481 5:111423990-111424012 AAGATCACACAGCTGGTCCATGG + Intronic
995836699 5:116406526-116406548 AAGGTCACACAGCAGAACCGTGG + Intronic
996077310 5:119211820-119211842 AAGGTCATACAGCAGATCCATGG - Intronic
996366100 5:122703019-122703041 AAGGACACACAGCTGGCAAAGGG - Intergenic
997337965 5:133121069-133121091 AAGGTCACACAGCCAGTGAACGG - Intergenic
997424417 5:133793521-133793543 AAGGTCTCACAGCTGGAACATGG + Intergenic
997472568 5:134124962-134124984 GAGGTCACACAGCAGGGGGAGGG - Intronic
997932059 5:138080870-138080892 AAGGTCACACAACAAGCCCAGGG + Intergenic
998177551 5:139911219-139911241 AAGGGCACACAGCAGGCCCCGGG - Intronic
998251921 5:140559125-140559147 AAGGTCACACAGCCAGAGAAAGG + Intronic
998602305 5:143597505-143597527 AAGGTCACACAGCTGGTGTGGGG + Intergenic
999247080 5:150160764-150160786 GAGGGCACACAGCAGGCCTAGGG + Intergenic
999309028 5:150539503-150539525 AAGGTCACACAGCCGAGGCAGGG - Intronic
999394055 5:151215301-151215323 AAGGTCACACAGCAAGCAGATGG - Intronic
999453353 5:151694879-151694901 AAAGTCACACAGTTGGCCCATGG + Intergenic
999638613 5:153648467-153648489 AAGGTCACACAGCTGACAAACGG - Intronic
999757222 5:154673532-154673554 AAGGTCACACAGGAGTCAGATGG + Intergenic
999817672 5:155193642-155193664 AAGGTCACACAGCACGAAAATGG + Intergenic
1000162855 5:158617154-158617176 AAGGTCACACAGCTGGGAAATGG - Intergenic
1000369508 5:160521099-160521121 AAGGTCACACAGCATGCAAAAGG - Intergenic
1000383678 5:160652142-160652164 AAGGAGACACAGCAGGAGGAAGG - Intronic
1001303832 5:170556991-170557013 AAGGTCACACAGCCAGCATATGG - Intronic
1001414723 5:171537109-171537131 AAGGTCACCCAGCATGCAAAAGG - Intergenic
1001602076 5:172935352-172935374 AGGGGCCCAGAGCAGGCGCAGGG - Intronic
1001759511 5:174195538-174195560 AGGGGCACACAGCATGTGCATGG + Intronic
1002181415 5:177432924-177432946 CAGGTCACACAGCAGGGGCAAGG - Intronic
1003728423 6:8792468-8792490 AAGGTCACACAGCTGGTAAACGG + Intergenic
1003978239 6:11364531-11364553 AAGGCCACACAGCAGGTACATGG + Intronic
1004871739 6:19912076-19912098 AAGATCACACAGCTGGTGAAAGG + Intergenic
1004991022 6:21138898-21138920 AAGGGCACACAGAAGGAGAAAGG - Intronic
1005911278 6:30311844-30311866 AAGGTCACACATCTGGTGTATGG - Intergenic
1006440907 6:34053208-34053230 AAGGTCACACAGCAGGGAGGAGG + Intronic
1006510900 6:34520503-34520525 AAGGTCACACAGCAGGAAGGAGG - Intronic
1006520574 6:34568789-34568811 GAAGTCACACAGCAGGGTCAGGG + Intergenic
1007216960 6:40247871-40247893 CAGGTGAGACAGCAGGAGCAAGG - Intergenic
1007248200 6:40477467-40477489 AAGGTCACACAGCCAGTGGATGG + Intronic
1007483811 6:42166992-42167014 CAGGTCACACAGCATACACAGGG - Intronic
1007636890 6:43305062-43305084 AAGGTCACACAGCAAGTTAATGG - Exonic
1007724719 6:43908256-43908278 AAGGCCACACAGCAGAGCCAGGG - Intergenic
1008132673 6:47736807-47736829 AAGGGCACACAGCAGGGAAATGG - Intergenic
1010433376 6:75803439-75803461 AAGGTCATACATCAGGACCAGGG + Intronic
1013900124 6:115145371-115145393 TAGGTCACACAGCTGGTGAATGG - Intergenic
1014619896 6:123654454-123654476 AAGGTCACCCAGCTGGTCCATGG + Intergenic
1014711871 6:124815966-124815988 AAGGTCACATAGCTGGCAAAGGG + Intronic
1015594157 6:134850354-134850376 AATGCAACACAGCAGGAGCATGG - Intergenic
1016933765 6:149433609-149433631 AAGGACACACAGCAGGTGGTAGG + Intergenic
1017861903 6:158406197-158406219 AAGGTCACAAAGCAAGTTCAAGG - Intronic
1018068178 6:160138163-160138185 AAGGTCACACAGCCAGGACATGG - Intronic
1018334977 6:162777221-162777243 AACGTCACACAGCCGGCACGAGG - Intronic
1018545369 6:164929810-164929832 AAGGTCACTCAGCAGCGGAAAGG - Intergenic
1018751843 6:166813238-166813260 AAGGTCCCACAGCAGCAGCCAGG + Intronic
1018925685 6:168205387-168205409 AAGGTCATACAGCAGGTCCGAGG - Intergenic
1019531010 7:1503529-1503551 AGCGTCACACAGCAGGCGAGTGG + Intronic
1019567705 7:1692740-1692762 TAGGTCACACAGCAGAGTCAGGG - Intronic
1019575557 7:1735944-1735966 AAGGTCACACAGCAGGCGCACGG + Intronic
1019631386 7:2051658-2051680 GAGGTGACCCGGCAGGCGCAGGG - Intronic
1020264832 7:6553409-6553431 AAGGTCACCCAGCTGGGGAATGG + Intergenic
1020278446 7:6637910-6637932 AAGGTCACAAAGCGGGCTCCTGG - Exonic
1020418951 7:7977853-7977875 AAGGTCAGGCAGCATGCACAGGG + Intronic
1022257287 7:28671747-28671769 AAGGTCACACAGCTGGCACGTGG - Intronic
1022291703 7:29010933-29010955 AAGGTCATACAGCTGGTACATGG + Intronic
1022638052 7:32155799-32155821 AAGGTCAGACAGCAGGCAAGGGG + Intronic
1022873780 7:34506827-34506849 AAGGTCCCACAGCTGACGCGTGG + Intergenic
1023254004 7:38294951-38294973 CAGGTCACACAGCTGGTTCATGG - Intergenic
1023639344 7:42241805-42241827 AATGTCACACAGCATCCACAGGG - Intergenic
1026228273 7:68461682-68461704 AAAGTCATACAGCAGAGGCAGGG + Intergenic
1026836927 7:73645814-73645836 AAGGTCACACAGCCTGGGAACGG - Intergenic
1026946749 7:74321058-74321080 AGGGTCACACAGCAGGAGCAGGG - Intronic
1027432462 7:78128681-78128703 AAGGTCACACTGAAAGTGCATGG + Intronic
1029351949 7:100019646-100019668 AAGGTCACACAGCAAGTATATGG - Intronic
1029427492 7:100505445-100505467 AAAGTCACACAGCAAGTGAATGG + Intergenic
1029610366 7:101623294-101623316 GAGGTCACACAGCAAGCACAGGG + Intronic
1029697324 7:102222396-102222418 AAAGTCACACAGATGGTGCAAGG - Intronic
1030580820 7:111352706-111352728 AAGTTCACACAGCAGCCGCATGG + Intronic
1030589855 7:111467167-111467189 AAGGTCACCCAGTAGGTGCTGGG - Intronic
1031680554 7:124668236-124668258 AAGTTCACACAGCTGGTACATGG - Intergenic
1031993071 7:128210466-128210488 GAGGCCACATAGCTGGCGCAGGG - Intergenic
1032055385 7:128680423-128680445 AAGCTAACAAAGCAGGCTCATGG + Intronic
1032455435 7:132069851-132069873 AAGGTCACAGAGCAAGCCAAAGG - Intergenic
1032487864 7:132301510-132301532 AAGGTCACACATCTGGCGGATGG + Intronic
1032498526 7:132381225-132381247 AAGGTCTCACAGCTGGCGTGAGG + Intronic
1032529956 7:132611769-132611791 AAGGTCACAGAGAAGGCTGAAGG - Intronic
1032578439 7:133081246-133081268 CAGGTCACAGAGGAGGCGCCTGG + Intronic
1032779463 7:135152192-135152214 AAGGTCACACAGCTGGTGAATGG + Intronic
1033334778 7:140443286-140443308 AAGGTCACACAGCTAGTGAATGG + Intergenic
1033648230 7:143321254-143321276 AGGGGCACACAGAAGGAGCACGG + Intronic
1033847756 7:145455036-145455058 AAAGTAACACAGTAGGGGCAGGG + Intergenic
1034265877 7:149780454-149780476 GGGGTTACACAGCTGGCGCACGG - Intergenic
1035651981 8:1273393-1273415 CAGGTCACACAGCTGGCTTATGG + Intergenic
1036631193 8:10516826-10516848 AAGGTCACATAGCAGGTACATGG + Intergenic
1036769894 8:11571731-11571753 ATGCTCACACGGCAGGTGCATGG + Intergenic
1037463525 8:19136818-19136840 AAGGCCACACAGCTGGAGAAGGG - Intergenic
1037860901 8:22404939-22404961 AATGTCACCCAGCACGTGCAAGG + Exonic
1037940247 8:22945819-22945841 AAGGTCACACAGCTAGTGAATGG + Intronic
1038061225 8:23915416-23915438 AAGGTCACACAGCTGGCAAGTGG - Intergenic
1038479836 8:27894247-27894269 AGGGTCACACAGCTGCCACATGG + Intronic
1041748771 8:61236821-61236843 CAGGTCACAGAGCTGGCGCAGGG + Intronic
1041986707 8:63930573-63930595 AAGGTCAAACTGATGGCGCAAGG + Intergenic
1044064636 8:87684482-87684504 AAGGACACACATGAGGGGCATGG + Intergenic
1045295546 8:100869178-100869200 AAAGTCACACAGCAGGAAAATGG - Intergenic
1045331099 8:101156327-101156349 AAGGTCACACAGAAGGCACATGG - Intergenic
1045883608 8:107069739-107069761 AAGGTTACAAAGCAGCCTCAGGG + Intergenic
1047224411 8:122944209-122944231 AAGGTCACACAGCTAGTTCATGG - Intronic
1047538163 8:125738194-125738216 GAGATCACACAGCAGGAGTATGG - Intergenic
1048377472 8:133835226-133835248 AAGATCACACAGCTGGCGAGTGG + Intergenic
1048570537 8:135651196-135651218 AAGGTCACAAAGCGGGTGAAGGG - Intronic
1048780148 8:137990929-137990951 ATGGGCACACGGCAGGGGCAAGG + Intergenic
1048866744 8:138767043-138767065 AAGGTCACACAGCTGGAGCGTGG - Intronic
1048937047 8:139366082-139366104 AAGGTCACAGAGCAGGCAAGGGG - Intergenic
1049429223 8:142551419-142551441 AGGGTCACACAGCTGGGGCCTGG + Intergenic
1049852980 8:144844103-144844125 TAGGTCACACAGCAAGCCCCTGG - Intronic
1052272986 9:26646564-26646586 AAAGTCACACTGCAGGTGTAGGG + Intergenic
1052600874 9:30629120-30629142 AAGGACACACTGCAAGCACATGG + Intergenic
1053273050 9:36763154-36763176 AAGGTCACCCGACAGGCGCTGGG - Intergenic
1053274231 9:36771155-36771177 AAGGTCACACAGGGGGCACATGG - Intergenic
1053422495 9:37988262-37988284 AAGGTCACACAGCTGGTGAGCGG - Intronic
1053484647 9:38442641-38442663 ACAGTCACACAGCTGGCGCGTGG + Intergenic
1053680960 9:40484924-40484946 AAGGTCACACAGCCTGTACATGG + Intergenic
1053930949 9:43113238-43113260 AAGGTCACACAGCCTGTACATGG + Intergenic
1054282753 9:63140011-63140033 AAGGTCACACAGCCTGTACATGG - Intergenic
1054294043 9:63320439-63320461 AAGGTCACACAGCCTGTACATGG + Intergenic
1054392067 9:64624928-64624950 AAGGTCACACAGCCTGTACATGG + Intergenic
1054426715 9:65130139-65130161 AAGGTCACACAGCCTGTACATGG + Intergenic
1054503662 9:65891400-65891422 AAGGTCACACAGCCTGTACATGG - Intronic
1054777288 9:69134360-69134382 CAAGTCCCACAGCAGGTGCAGGG + Intronic
1054857900 9:69920870-69920892 AAGGTGACACAGCTGGCAAACGG - Intergenic
1055361200 9:75492257-75492279 AAGGTCACACAGCCAGCAGATGG + Intergenic
1056559644 9:87718973-87718995 CAGGTCACAGAGCAGGTGGAGGG - Intergenic
1057197243 9:93121893-93121915 AAGGACACACAGCAGGTCCGTGG - Exonic
1057745085 9:97745096-97745118 AAGGTCACACAGCTGGTGAGTGG + Intergenic
1057858328 9:98619933-98619955 AAGGCCACACAGCAGGTGAGTGG - Intronic
1057892926 9:98882722-98882744 AAGGTCACACAGCAGATGAGGGG + Intergenic
1058894227 9:109385995-109386017 CAGGACTCACAGCAGGCGTATGG - Intronic
1059362132 9:113753168-113753190 AAGGTCACACAGCAGGTTAACGG + Intergenic
1059404516 9:114091823-114091845 GAGGTCACACAGCAGTCTCCTGG + Exonic
1059458120 9:114412516-114412538 AAGGTCACACAGCAAGGACAGGG + Intronic
1059499254 9:114737221-114737243 CAGGTCACACAGCAGGAGCTGGG - Intergenic
1059745465 9:117196146-117196168 AAGGTAACACAGCTGGAGTATGG - Intronic
1059969334 9:119648872-119648894 AAGGTCACACAGCTGGTTAATGG + Intergenic
1059990007 9:119856005-119856027 AAGGTCACACAGCTGGTAAATGG + Intergenic
1060145227 9:121247123-121247145 AAAGTCAGCCAGCAGGGGCAAGG + Intronic
1060246974 9:121954979-121955001 AAGTTCACAGAGCAGCCACAAGG + Intronic
1060276535 9:122186972-122186994 AAGGTCACACAGCTGGTGAGTGG - Intronic
1060400330 9:123344858-123344880 AAGGTCACACAGCTGGTAGAAGG - Intergenic
1060521309 9:124295559-124295581 CAGGTCACACAGCAGGCGGCAGG - Intronic
1060667264 9:125439344-125439366 CAGGTCACACAGCAGGTGGGAGG - Intronic
1060720402 9:125972723-125972745 AAGATCACACAGCAGGTGAGTGG - Intergenic
1060978014 9:127776739-127776761 AGGGTCACACAGCAAGGCCATGG + Intronic
1061082787 9:128382231-128382253 TGGGTCACACAGCAGACCCATGG + Intronic
1061218557 9:129235841-129235863 AAGGACACACAGTGGGTGCAGGG + Intergenic
1061389988 9:130312132-130312154 AAGATCACACAGCTGGCGAGTGG + Intronic
1061394470 9:130336539-130336561 AACCTCACACAGCTAGCGCATGG + Intronic
1061408527 9:130405813-130405835 AAGGTCACACAGCTAGCAAACGG - Intronic
1061414388 9:130438463-130438485 AAGGTCACACAGAAAGCCCAAGG + Intergenic
1062340364 9:136091341-136091363 AAGGTCACACAGCCTGGGCTGGG + Intronic
1062352934 9:136148037-136148059 AAGGCCACACAGCAGGTGGAGGG + Intergenic
1062443773 9:136584875-136584897 AAGATCACACAGCCAGCGCAGGG + Intergenic
1062562479 9:137147814-137147836 GGGGCCACACAGCAGGTGCACGG + Intronic
1187435799 X:19267914-19267936 AAGGTCAGTCAGAAGGCTCAGGG + Intergenic
1188687567 X:33087631-33087653 AAGGTCACACAGCTATCACATGG - Intronic
1189195778 X:39151173-39151195 AAGGTCACACAGCCAGTACATGG - Intergenic
1189226929 X:39420745-39420767 AAGGTCACACAGCTGGTGAGTGG + Intergenic
1189363493 X:40370705-40370727 AAGGTCACATAGCAGGAGGCAGG - Intergenic
1190486355 X:50928924-50928946 GAGGTCACATAGCCGGCACAAGG + Intergenic
1191690759 X:63935636-63935658 AAGGTCACACAGCAAGCCAGTGG + Intergenic
1192212172 X:69134699-69134721 AAGGTCAAGCAGCAGGCAGATGG - Intergenic
1192236765 X:69301103-69301125 AAGGTCACACTGAATGCTCAAGG - Intergenic
1192448727 X:71229444-71229466 AAGGTCAGCCAGCAGCTGCATGG + Intergenic
1195573220 X:106420170-106420192 AAGGTCACACAACTGGTGGAAGG - Intergenic
1195688928 X:107608308-107608330 AAGGTCACACAGCTGGTAAATGG + Intergenic
1195705439 X:107734959-107734981 AAGGTCACACAGCTAGAGCTGGG + Intronic
1195988927 X:110663484-110663506 AAAGTCACACAGCAAGGACAGGG + Intergenic
1197710044 X:129659463-129659485 AAGGTCACACAGCTAACGAATGG - Intergenic
1197898243 X:131340653-131340675 AAGGTCACACAGCTAGTGAATGG - Intronic
1198587641 X:138140370-138140392 AAGATAATACAGCAGGAGCAAGG + Intergenic
1198683836 X:139207106-139207128 GAGGTCACACAGCTGGTACATGG + Intronic
1198703547 X:139422470-139422492 AAGCTCACTCAGCAGGCAAATGG + Intergenic