ID: 1019575621

View in Genome Browser
Species Human (GRCh38)
Location 7:1736288-1736310
Sequence CAGGGGGAAAGGTGGGCGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1370
Summary {0: 1, 1: 1, 2: 12, 3: 101, 4: 1255}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019575621_1019575634 24 Left 1019575621 7:1736288-1736310 CCCTCCGCCCACCTTTCCCCCTG 0: 1
1: 1
2: 12
3: 101
4: 1255
Right 1019575634 7:1736335-1736357 CAGAATCCTCAGTCCAGCCCCGG 0: 1
1: 0
2: 2
3: 24
4: 292
1019575621_1019575636 30 Left 1019575621 7:1736288-1736310 CCCTCCGCCCACCTTTCCCCCTG 0: 1
1: 1
2: 12
3: 101
4: 1255
Right 1019575636 7:1736341-1736363 CCTCAGTCCAGCCCCGGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019575621 Original CRISPR CAGGGGGAAAGGTGGGCGGA GGG (reversed) Intronic
900419139 1:2548032-2548054 CAGGGGGAGGGGAGGGAGGAGGG + Intergenic
900578160 1:3394375-3394397 CAGAGGGCTGGGTGGGCGGACGG - Intronic
900735629 1:4297845-4297867 CAGGTGGAAATGTGAGTGGACGG + Intergenic
900767773 1:4516784-4516806 CTGGGGACAAGGTGGGCAGAGGG + Intergenic
901040033 1:6358251-6358273 AAGAGGGAAGGGTGGGAGGAAGG + Intronic
901198502 1:7453618-7453640 GAGGGGGACATGTGGGCAGATGG + Intronic
901406713 1:9052776-9052798 CAGAGGCCAAGGTGGGAGGATGG + Intronic
901728723 1:11262512-11262534 CAGCGGGGAAGGCGGGCGGTGGG - Intergenic
901771356 1:11531936-11531958 GAAGGGGAAAGGTGGGTGGAAGG - Intronic
901789367 1:11646398-11646420 CAGGGAGATGGGTGGGAGGAAGG - Intergenic
902328310 1:15717143-15717165 CAGGGGCTGAGGTGGGAGGATGG + Intronic
902551702 1:17223363-17223385 GTGGGGGAAAGGTGGAGGGATGG - Intronic
902553350 1:17232343-17232365 CAGGGGGTGAAGTGGGAGGATGG - Intronic
902678209 1:18023755-18023777 TTGGGGAAAAGGTGGGAGGAAGG + Intergenic
902775424 1:18671505-18671527 CAGTGGGCCAGGTGGGAGGAGGG + Intronic
903049079 1:20587640-20587662 CAGGGGGAAAGGCAGGGGAAAGG - Intergenic
903179505 1:21598122-21598144 CGGGGGCATAGGTGGGCGGTCGG + Intronic
903352189 1:22724211-22724233 AAGGGGGAAAGGGGAGCAGAGGG - Intronic
903353338 1:22731231-22731253 CGGGGGGAATGGAGGGCAGAGGG + Intronic
903768758 1:25750990-25751012 CAGAAGGAAAGATGGACGGAAGG - Intronic
904308189 1:29604180-29604202 AAGGGGGAAAGAAGGGTGGAAGG - Intergenic
904433430 1:30479493-30479515 CTAGGGGAGAGGTGGACGGAGGG - Intergenic
904443554 1:30549883-30549905 GAGGGAGGAAGGTGGGAGGAGGG - Intergenic
904652031 1:32013331-32013353 CAGGGAGAAAGGAAGGCTGAGGG - Intergenic
904870546 1:33615103-33615125 CAGGGGGCAGGGTGGGCGGCAGG + Intronic
905222424 1:36457861-36457883 CTGGGGGAAAGGGGTCCGGAGGG - Intronic
905456323 1:38090534-38090556 CAGGGGGAAAGGAAAGGGGATGG + Intergenic
905863304 1:41364093-41364115 CATGGGGAAAGATGGGAAGAGGG + Intronic
905874188 1:41422015-41422037 AAGGGGGATAGATGGGAGGAGGG + Intergenic
905875676 1:41430872-41430894 CTGGGGAAAAGGTGGGCAGTGGG + Intergenic
905974894 1:42167809-42167831 CTGGGGGAAAGGTGAGGGGCAGG + Intergenic
906449644 1:45934061-45934083 CAGGGTGGAGGGTGGGAGGAGGG - Intronic
906521934 1:46472357-46472379 CAGGGGGGCAGGCGGGCGGCTGG - Intergenic
906915121 1:50000903-50000925 CAGGGGGAAGGGTGGGAGGAGGG + Intronic
907303791 1:53502983-53503005 CAGGGAGAGAGGAGGGGGGAAGG + Intergenic
907338489 1:53716281-53716303 CAGGGGGAGAGGGAGGCAGAGGG + Intronic
907561432 1:55393067-55393089 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
907578611 1:55551485-55551507 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
907673662 1:56499075-56499097 AAGGGGGGAAGGTGGGGGGGGGG - Intronic
907820492 1:57963004-57963026 CAAGAGGAAAGGTGGGCAAAAGG - Intronic
908517454 1:64907537-64907559 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
908664885 1:66478990-66479012 GAGGGTGGAAGGTGGGAGGAGGG + Intergenic
908668101 1:66514786-66514808 CAGAGGAAAGGGTGGGAGGAGGG + Intergenic
908863002 1:68511242-68511264 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
908998794 1:70192811-70192833 GAGGGTGGAAGGTGGGAGGAGGG + Intronic
909487157 1:76186991-76187013 AAGTGGGAAGGGTGGGAGGAAGG - Intronic
909533348 1:76706212-76706234 CAGGAAGAAAGGAGGGAGGAAGG - Intergenic
909695131 1:78459636-78459658 GAGGGTGAAAGGTGGGAGGAGGG - Intronic
910022439 1:82608495-82608517 CAAGGGGAATGGTGGGAGGGGGG + Intergenic
910337917 1:86155373-86155395 CAGGAGGCTAGGTGGGAGGAGGG - Intronic
910388066 1:86705454-86705476 CAGGGAGAAAGAGGGCCGGAGGG - Intronic
910572431 1:88720773-88720795 CAGAGGGAAAGGTGGGAGTGGGG - Intronic
911175257 1:94811704-94811726 CAGGGAGGGAGGTGGGGGGAAGG - Intergenic
911571531 1:99523351-99523373 CAGGGTGGAGGGTGGGAGGAAGG - Intergenic
911850532 1:102813598-102813620 CAGGGGCAAAAGTGGGAAGAGGG - Intergenic
912216262 1:107616435-107616457 GAGGGTGGAAGGTGGGAGGAGGG + Intronic
912728781 1:112082755-112082777 GAGGGAGAAAGGTGGAAGGAGGG + Intergenic
912732627 1:112122619-112122641 GAGGGTGGAAGGTGGGAGGAGGG + Intergenic
912813416 1:112810667-112810689 AAGGGGGAATGGAGGGCGGAAGG - Intergenic
913056007 1:115160063-115160085 GAGGGGGAAAGGGAGGGGGAGGG + Intergenic
913356143 1:117924274-117924296 GAGGGTGAAAGGTGGGAAGAGGG - Intronic
915425263 1:155820739-155820761 TAGGGGCCAAGGTGGGAGGATGG + Intronic
915462060 1:156076226-156076248 CAGCGGGGGAGGTGGGCAGAGGG + Exonic
915784167 1:158589344-158589366 GAGGGTGAAAGGTGGCAGGAGGG + Intergenic
915932718 1:160070064-160070086 CAGCGGGACAGATGGACGGACGG + Exonic
916079751 1:161225122-161225144 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
916298498 1:163247081-163247103 GAGGGTGAAAGGTGGGAGAAGGG + Intronic
916382210 1:164224530-164224552 CAGGGGGAAGGGCAGGAGGAAGG + Intergenic
916407401 1:164510982-164511004 CAGAGGGGAAGGTGAGAGGAAGG - Intergenic
916457417 1:164985272-164985294 GAGGGTGGAAGGTGGGAGGAGGG - Intergenic
917270177 1:173263978-173264000 GAGGGTGGAAGGTGGGAGGAGGG + Intergenic
917316943 1:173735747-173735769 CAGGGGGAAGTGTGGGAGGTGGG - Intronic
917990155 1:180367525-180367547 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
918101299 1:181377272-181377294 CAGGGGTAGAGTTGGGTGGAAGG + Intergenic
918782399 1:188718155-188718177 AAGAGGGAAGGGTGGGAGGAGGG - Intergenic
918866143 1:189903162-189903184 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
919142256 1:193587279-193587301 GAGGGTGAAAGGTGCGAGGAGGG + Intergenic
919187383 1:194170077-194170099 AAGGGGGGAAGGTGGTAGGAGGG - Intergenic
919489930 1:198194437-198194459 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
919685752 1:200482135-200482157 CAGGGGGAAAGGGGTGAGGGAGG + Intergenic
919719258 1:200814131-200814153 CGGGGGGAGGGGTGGGCGGGTGG + Intronic
919888798 1:201955169-201955191 AAGGGGGAAGGGAAGGCGGAAGG + Intergenic
920086471 1:203421312-203421334 GAGGGGGAAAGGGGAGGGGATGG + Intergenic
920192467 1:204202367-204202389 CAGGAGAAAAGGTGTGGGGAAGG - Intronic
920232689 1:204481053-204481075 CAGGGGGAAAAGTATGTGGAGGG - Intronic
920406839 1:205721115-205721137 GAGGGGGCAGGGTGGGGGGATGG + Intronic
920556861 1:206910198-206910220 AAGGAGGAAAGGTGAGCGGCTGG - Exonic
920595896 1:207269614-207269636 CAGGGTGGAAGTTGGGAGGAGGG - Intergenic
920904047 1:210142755-210142777 CAGTGGGAAATGGGGGAGGAAGG - Intronic
921036941 1:211388835-211388857 CAGGGTTAAAGGTGGGGAGAGGG + Intergenic
921217596 1:212950821-212950843 CTCGGGGAAAAGGGGGCGGATGG + Intronic
921327222 1:213997971-213997993 AAGGGGGAAGGGGTGGCGGAAGG - Exonic
922367271 1:224877801-224877823 CTGGGGGAAAGGTAGGAGGGGGG + Intergenic
922391460 1:225147778-225147800 GAGGGTGGAAGGTGGGAGGAGGG - Intronic
922598824 1:226834497-226834519 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
922792703 1:228318915-228318937 CGGGGGGCAAGCTGGGCTGAGGG - Exonic
922883904 1:229003491-229003513 CAGGGGGAGGGGAGGGAGGAAGG + Intergenic
922907367 1:229184497-229184519 GAGGGTGGAAGGTGGGAGGAAGG + Intergenic
922943796 1:229492758-229492780 GAAGGGGAAGGGTGGGAGGAGGG + Intronic
922946790 1:229523247-229523269 CTGGAGGAAAGGAGGGAGGATGG - Intronic
923714064 1:236410237-236410259 AAGGGGGGAGGGTGGGAGGAGGG - Intronic
923855926 1:237845481-237845503 GAGGGTGGAAGGTGGGAGGAGGG + Intergenic
924473879 1:244366967-244366989 CAGGTGGAGAGGTAGGCAGAAGG + Intronic
1062818430 10:516817-516839 CAGGGGGTAGGGTGGGAGGGGGG + Intronic
1062929552 10:1343871-1343893 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1063338820 10:5243892-5243914 AGGGAGGAAAGGTGGGAGGAGGG + Intergenic
1063558560 10:7104375-7104397 GATGGGGGAAGGTGGGAGGAGGG - Intergenic
1063705238 10:8423925-8423947 CAGCGGGAAGGTTGGGAGGAGGG + Intergenic
1063738587 10:8791640-8791662 GAGGGTGGAAGGTGGGAGGAGGG - Intergenic
1064114766 10:12568330-12568352 GAGGGGGAGAGGAGGGGGGAGGG - Intronic
1064114828 10:12568521-12568543 CAGGAAGAAAGGTGAGGGGAGGG - Intronic
1064884170 10:20091240-20091262 CAGGGGGAAAGGTATGCTGGTGG - Intronic
1064917290 10:20474092-20474114 GAGAGGGAAGGGTGGGAGGAGGG + Intergenic
1065198600 10:23291588-23291610 CAGAGGGAAGTGTGGGTGGAGGG - Intronic
1065543081 10:26789771-26789793 GAGGGTGAAAGGTGGGAAGAGGG - Intronic
1065827688 10:29586891-29586913 CAGGGTGGAGGGTGGGAGGAGGG + Intronic
1066048598 10:31615916-31615938 CTGGGGGAAAGGTAGGCAGGTGG + Intergenic
1066103514 10:32137900-32137922 AAGGGGAAATGGAGGGCGGAAGG + Intergenic
1066174166 10:32886642-32886664 GAGGGGGGAGGGTGGGAGGAGGG + Intergenic
1066252402 10:33647208-33647230 GAGGGTGAAGGGTGGGAGGACGG + Intergenic
1066784423 10:38987439-38987461 CAGGGGAAAGGCTGGGAGGAGGG - Intergenic
1067141256 10:43659046-43659068 CAGGTGGGAAAGTGGACGGAGGG + Intergenic
1067452205 10:46388688-46388710 CAAGGGGAATGGGGGGCAGAGGG + Intronic
1067481034 10:46597796-46597818 CGGGGGGTAGGGAGGGCGGAAGG - Intergenic
1067585032 10:47471067-47471089 CAAGGGGAATGGGGGGCAGAGGG - Intronic
1067613717 10:47744026-47744048 CGGGGGGTAGGGAGGGCGGAAGG + Intergenic
1068067611 10:52151227-52151249 GAGGGTGAAAGGTGAGAGGAGGG - Intronic
1068838708 10:61586277-61586299 AAGGGGGAAACGTGAGTGGAGGG + Intergenic
1068858175 10:61818840-61818862 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1069059177 10:63875932-63875954 GAGGGGGGAAGGTGGGAGGAGGG - Intergenic
1069113399 10:64474396-64474418 CAGGGGGAAAGGGTGGGAGAGGG + Intergenic
1070118621 10:73553517-73553539 CTCTGGGAAAGGTGGGAGGAGGG - Intronic
1070421392 10:76241105-76241127 TTGGGGGAAAGGTGGGTGGGTGG + Intronic
1070455997 10:76616215-76616237 GAGGGTGGAAGGTGGGCGGAGGG + Intergenic
1070467919 10:76743269-76743291 AAGTGGGAAAGCTGGGTGGATGG + Intergenic
1071187087 10:83058393-83058415 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1071373610 10:84979506-84979528 CAGGGGGAAGGTTGGGAGGGGGG - Intergenic
1071504775 10:86226047-86226069 CAGGTGGACAGGTAGGCTGATGG + Intronic
1071629128 10:87203998-87204020 CGGGGGGTAGGGAGGGCGGAAGG + Intergenic
1071889944 10:89993479-89993501 CAGGGGAAAGGGTGGGAGAATGG - Intergenic
1071895045 10:90057109-90057131 CAGGGGAAAAGGTGGGAGGAAGG + Intergenic
1072223246 10:93345438-93345460 CAGGGGGATAGCGGGGAGGAGGG + Intronic
1072259992 10:93660548-93660570 CAGGGGAGAAGGTCGGGGGAAGG + Intronic
1072366987 10:94721602-94721624 AAGGTGGAAAGGTGGGAGGGAGG - Intronic
1072725048 10:97807498-97807520 CAGGGGAAAAGGTGGCTGTAGGG + Intergenic
1073108334 10:101046216-101046238 CAGAGGCCAAGGTGGGAGGATGG + Intergenic
1073115239 10:101088032-101088054 AAGGGGGGAAGCTGGGAGGAAGG + Intergenic
1073337856 10:102723970-102723992 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1073387828 10:103142139-103142161 CAGGGGGCAAGGATGGGGGAAGG + Intronic
1074712386 10:116188151-116188173 CAGGTGGAATGGTTGGGGGAGGG + Intronic
1074739840 10:116475283-116475305 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1074886633 10:117699205-117699227 ATGGAGGAAAGGTGGGCAGAGGG + Intergenic
1075087303 10:119422178-119422200 GAGGGTGAATGGTGGGAGGAGGG + Intronic
1075162531 10:120037096-120037118 GAGGGTGGAAGGTGGGTGGAGGG + Intergenic
1075201038 10:120404353-120404375 CAGGTGGAAAGGTGGAAGGGTGG + Intergenic
1075217371 10:120548220-120548242 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1075407789 10:122206091-122206113 CGGGGGGAAAGAGGGGAGGATGG + Intronic
1075840549 10:125498717-125498739 CAGGGTGGAGGGTGGGAGGAGGG - Intergenic
1076091543 10:127690421-127690443 CATGGGGGAAGGTGGGAAGAAGG + Intergenic
1076542680 10:131224097-131224119 CAGGGGGAAAGGAGACAGGAAGG - Intronic
1076608867 10:131707915-131707937 CAGGGGGATCAGTGGGCAGAGGG + Intergenic
1076630868 10:131851297-131851319 CAGGTGGAAAGGTGTGCAGCAGG - Intergenic
1076662368 10:132064334-132064356 CAGGAGGACAGCTGGGCTGAGGG + Intergenic
1076704282 10:132292897-132292919 CATGGGGAAGGGAGGGGGGAGGG - Intronic
1076822139 10:132944682-132944704 CAGCGGGAAAGGAGGCGGGAAGG + Intergenic
1076857738 10:133125861-133125883 CAGGAGGAAAGGTGGGAGGCAGG - Intronic
1076867353 10:133174617-133174639 TAGGTGGATAGGTGGGTGGATGG + Intronic
1077102515 11:828459-828481 CAGGTGGGAAGGTGGGCGGAAGG - Intronic
1077108689 11:852831-852853 CAGGGGTTAAGGTGGTGGGAGGG + Intronic
1077186680 11:1238605-1238627 CAGGTGCATAGGTGGGCAGATGG + Intronic
1077186684 11:1238621-1238643 CAGATGGACAGGTGGGCAGATGG + Intronic
1077383439 11:2258064-2258086 CAGGGAGATGGGTGGGTGGAGGG - Intergenic
1077489313 11:2853160-2853182 CCTGGGGATAGGTGGGCGGTGGG - Intergenic
1077595341 11:3527046-3527068 CTGGGGGAAAGGGGAGGGGATGG - Intergenic
1077670668 11:4154516-4154538 TAGGGGCAAAGGTGGGCACAGGG - Intergenic
1077751455 11:4974952-4974974 CAGGGGTTGAGGTGGGGGGAGGG + Intronic
1077800181 11:5529080-5529102 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1078109302 11:8379767-8379789 GAGGGTGAAGGGTGGGTGGAGGG - Intergenic
1078159012 11:8824342-8824364 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1078755815 11:14208203-14208225 GAAGGTGAAAGGTGGGAGGAGGG + Intronic
1078816629 11:14829153-14829175 GAGGGTGGAGGGTGGGCGGAGGG + Intronic
1079358926 11:19754174-19754196 AAGGGGAAAAGTTGGGAGGAAGG - Intronic
1079576890 11:22015471-22015493 GAGGGTGGAAGGTGGGAGGAAGG - Intergenic
1080114569 11:28607226-28607248 GAGGGGGAGAGGAGGGAGGATGG - Intergenic
1080567883 11:33528820-33528842 CCGGGGGAAAGGTGTGAGGGTGG + Intergenic
1080706158 11:34696169-34696191 GAGGGTGGAAGGTGGGAGGAGGG - Intergenic
1080863336 11:36170013-36170035 GAGAGGGAAGGGTGGGAGGAGGG - Intronic
1081379995 11:42402707-42402729 GAGGGTGGAAGGTGGGAGGAGGG + Intergenic
1081504008 11:43695986-43696008 GAGGGTGGAAGGTGGGAGGAGGG - Intronic
1081539493 11:44020774-44020796 CAGGGGAAATGGTGGGAGGGGGG - Intergenic
1081782429 11:45722409-45722431 CAGGGGGAATGGGGAGGGGACGG + Intergenic
1082162503 11:48900587-48900609 CAGCGGGACAGGTGGGAGGCCGG + Intergenic
1082222506 11:49656946-49656968 TTGGAGGAAAGGTGGGTGGATGG + Intergenic
1082673789 11:56070350-56070372 GAGGGTGGAAGGTGGGAGGAAGG - Intergenic
1082712058 11:56565093-56565115 GAGGGGGGAGGGTGGGAGGAGGG - Intergenic
1082795226 11:57374109-57374131 GAGGGTGAAGGGTAGGCGGAGGG + Intergenic
1082895658 11:58187523-58187545 GAGGGTGGAAGGTGGGAGGAGGG - Intergenic
1083078230 11:60063861-60063883 CAGGGGGAAAGGTGGGAAGGAGG + Intronic
1083592565 11:63904181-63904203 AAGGGGGTAGGGTGGGCTGAGGG - Intronic
1083594219 11:63911414-63911436 CAGGGGGGGAGGTGGGCAGAGGG - Exonic
1084232154 11:67760945-67760967 AAGGAGGAAAGGAGGGTGGAAGG - Intergenic
1084439305 11:69162631-69162653 GAGGGTGGAAGGTGGGAGGAGGG - Intergenic
1084456769 11:69272393-69272415 CAGTGGGACAGGTGGGCAGATGG - Intergenic
1084578879 11:70009919-70009941 TTGGGGGAAGGGTGGGAGGAGGG - Intergenic
1084821603 11:71695013-71695035 CTGGGGGAAAGGGGAGGGGATGG + Intergenic
1085010498 11:73137694-73137716 CAGGTGAAAAAGTGGGAGGAAGG + Intronic
1085021906 11:73215387-73215409 CAGGGGGCACTGTGGGCAGAGGG + Intergenic
1085023983 11:73226003-73226025 CAGTGTGAAAGGTGGACAGACGG + Intronic
1085410521 11:76287906-76287928 CAGGGTGGAAGGTGGAAGGAAGG + Intergenic
1085986061 11:81789932-81789954 CGGGGGAAAGGGTGGGAGGAGGG + Intergenic
1086017741 11:82187443-82187465 CAGGGTGGAGGGTGGGAGGAGGG - Intergenic
1086068535 11:82772635-82772657 GAGGGTGAACGGTGGGAGGAGGG - Intergenic
1086193985 11:84115214-84115236 CAGTGAGAATGGTGGGCTGAGGG - Intronic
1086399809 11:86451279-86451301 CTGGGGAAAAGGTAGGTGGATGG + Intronic
1086626544 11:88962260-88962282 TTGGAGGAAAGGTGGGTGGATGG - Intronic
1086955581 11:92931765-92931787 GAGGGAGAAAGATGGGAGGAAGG - Intergenic
1087054457 11:93919992-93920014 CATGGGGAGTGGTGGGAGGATGG + Intergenic
1087741144 11:101888355-101888377 GAGGGTGAAAGGTGGGAGGAGGG + Intergenic
1088270765 11:108032019-108032041 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1088378060 11:109163264-109163286 CAGGGGGTGAGGTTGGGGGATGG - Intergenic
1088420356 11:109638354-109638376 GAGGGGGGAGGGTGGGAGGAGGG - Intergenic
1088692159 11:112337406-112337428 AAGAGGGAAAGGAGGGAGGAAGG - Intergenic
1088998312 11:115024587-115024609 CAGAGGGAAGGTTGGGAGGAGGG + Intergenic
1089028894 11:115302151-115302173 GAGGGGGAAGGGTGGAAGGAGGG + Intronic
1089420435 11:118329107-118329129 CAGGGTGGAGGGTGGGAGGAGGG + Intergenic
1089538102 11:119173016-119173038 CAGGGGGTGTGGTGGGCAGACGG + Intronic
1089569241 11:119392137-119392159 CAGGGAAAAGGGTGGGAGGAAGG - Intergenic
1089573000 11:119422610-119422632 CTGGGTGGAAGGCGGGCGGACGG - Intronic
1089581306 11:119483419-119483441 GAGGGGGGAAGGTGGGGAGAAGG - Intergenic
1090065459 11:123499490-123499512 CAAGGAGAAAGGTGGGTGGAGGG + Intergenic
1090114629 11:123955489-123955511 CAGGGGGTTGGGTGGGAGGAAGG + Intergenic
1091111125 11:132969100-132969122 CAGGGGGAAGGGTGGGAGGGGGG - Intronic
1091441167 12:512464-512486 GAAGGTGGAAGGTGGGCGGAAGG - Intronic
1091805466 12:3352940-3352962 CAGGGGGAAACGTGTGCAGGAGG + Intergenic
1091879986 12:3969247-3969269 ATGGGGGAAAGGTGGGTGGGAGG - Intergenic
1092421498 12:8335820-8335842 CTGGGGGAAAGGGGAGGGGATGG - Intergenic
1092440809 12:8500499-8500521 GAGGGTGGAAGGTGGGAGGATGG + Intergenic
1092474345 12:8806196-8806218 AAGGAGGAAAGGAGGGTGGAAGG - Intergenic
1092843236 12:12562549-12562571 GAGGGGGAAAGGCGGGGGGGTGG + Intergenic
1093113892 12:15185681-15185703 GAGGGGGAAAGGTAAGAGGAGGG + Intronic
1093322131 12:17724737-17724759 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1093955638 12:25214863-25214885 CAGGGGGAAAAGAGGGCGGTAGG + Intronic
1095142928 12:38688818-38688840 GGCGGGGAAAGGTGGGAGGAAGG + Intronic
1095258818 12:40074689-40074711 AAGGGGGAAAAATGGGCTGAAGG - Intronic
1095536095 12:43249445-43249467 CAGGGGAAAGGGTGGGAGGGAGG + Intergenic
1095846366 12:46749677-46749699 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1096014902 12:48261898-48261920 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1096014909 12:48261916-48261938 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1096014916 12:48261934-48261956 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1096014923 12:48261952-48261974 AAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1096051133 12:48609099-48609121 CAGGGGGTGAGGTGGGGGGTGGG - Intergenic
1096257726 12:50073311-50073333 CAGTGGGAAAGGGAGGCTGATGG - Intronic
1096344806 12:50836438-50836460 CAGGGGGAAGGGTGGGAGAGGGG + Intergenic
1096348519 12:50873182-50873204 CAGGGGAAAGGGTGGGAGGGGGG + Intronic
1096524553 12:52202766-52202788 CAGGGGGAGGGGTGGGATGAGGG + Intergenic
1096675018 12:53221614-53221636 AAGGGGGTGAGGTGGGCGGGGGG + Intronic
1096924541 12:55128958-55128980 CAGGGTGGAAGGTGGGAGGAGGG + Intergenic
1097265870 12:57744643-57744665 CAGGGGGAAGGGGGTGGGGAAGG + Intronic
1097280803 12:57844895-57844917 AGGGGGGAAGGGTGGGGGGAGGG - Intronic
1097338140 12:58407650-58407672 CAGGGTGGAGGGTGGGAGGAGGG - Intergenic
1097508326 12:60504765-60504787 CAGGGGTAAAGGTGAGAGAATGG + Intergenic
1097536868 12:60883325-60883347 CAGGGGAAAGGTTGGGAGGAGGG - Intergenic
1097542345 12:60956446-60956468 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1097957953 12:65505863-65505885 CAAGGGGAAAGGGGAGCTGAAGG - Intergenic
1098051971 12:66463725-66463747 CAAGGGGAAAGATGGGGGCAGGG + Intronic
1098280083 12:68853815-68853837 GAGAGGGAAAGGAGGGAGGAAGG + Exonic
1098740467 12:74167697-74167719 CAGGGGAAAGGGTGGGAGGGAGG + Intergenic
1099329827 12:81269914-81269936 GAGGGGGAAAGGGTGGGGGATGG + Intronic
1099383880 12:81990171-81990193 AAGGGGGAAAAGTGGGCTGGAGG + Intergenic
1099396673 12:82148300-82148322 GAGGGTGGAAGGTGGGAGGAGGG - Intergenic
1100251581 12:92830314-92830336 GAGGGTGGAAGGTGGGAGGAGGG - Intronic
1100614342 12:96219589-96219611 TAGGGGGACAGGTGGGCAGTGGG - Intronic
1100670948 12:96812303-96812325 CAGAGGGAAAGGTGGGCCAAGGG - Intronic
1101063069 12:100991479-100991501 TAGGGGGTGAGGTGGGAGGAGGG + Intronic
1101075899 12:101129598-101129620 CAGGGGAAACGGTGGAAGGAGGG + Intergenic
1101082002 12:101196153-101196175 GAGGGTGGAAGGTGGGAGGAGGG - Intronic
1101447007 12:104743756-104743778 GAGGGTGGAAGGTGGGAGGAGGG - Intronic
1102072321 12:110031017-110031039 CTGGGGGAGAGGCGGGGGGATGG + Intronic
1103004393 12:117409507-117409529 AAGGGGGATAGATGGGTGGATGG + Intronic
1103006596 12:117425661-117425683 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1103247877 12:119473600-119473622 CTGGGGGAAGGGTGGGAGGAGGG - Intronic
1103254263 12:119527263-119527285 GAGGGGGGATGGTGGGAGGAGGG + Intronic
1103425480 12:120830334-120830356 GAGGTGGAAAGGAGGGGGGAGGG + Intronic
1103597788 12:122034784-122034806 CCGGGAGAAAGGAGGGAGGATGG - Intronic
1103900151 12:124299501-124299523 CAGGGGAAAGGGTGGGAAGAGGG - Intronic
1103917815 12:124385025-124385047 GAGGGAGAAAGGAGGGAGGAAGG + Intronic
1104176889 12:126341762-126341784 GAGGGTGGAGGGTGGGCGGAGGG - Intergenic
1104437488 12:128767385-128767407 CAGGGGGGAGGGAGGGAGGAAGG + Intergenic
1104575713 12:129964185-129964207 CAGTGGAAAAGGTGGGGAGAAGG + Intergenic
1104745909 12:131210425-131210447 CAGAGGGGAATGTGGGCAGAGGG + Intergenic
1104950243 12:132436790-132436812 CGGGGGGACAGGTGGGCTCAGGG - Intergenic
1104954641 12:132458114-132458136 TAGGTGGACAGGTGGGTGGACGG + Intergenic
1105437579 13:20391226-20391248 TAGGGGGAAAGGGAGGCGGGGGG + Intergenic
1105597737 13:21855328-21855350 CGGGGGGAAGGGTGGGAGGGGGG - Intergenic
1106990198 13:35409729-35409751 CAGGGGAAAAGGAAGGCAGAAGG + Intronic
1106991924 13:35429768-35429790 CAGGGGAAAGGGTGGGAGGTGGG - Intronic
1107223597 13:38018669-38018691 GAGGGTGAAGGGTGGGAGGAAGG - Intergenic
1107807144 13:44164138-44164160 CAGAGAGGAAGGTGGGCCGATGG - Intergenic
1108024848 13:46167131-46167153 CAGGGTGGAAGGTAGGGGGAAGG + Intronic
1108151299 13:47537521-47537543 CAGGGAGAAGGGTGGGAGGGAGG + Intergenic
1108327508 13:49348326-49348348 CAGGGGCCAAGGCAGGCGGATGG + Intronic
1108813052 13:54253589-54253611 GAGGGTGGAAGGTGGGTGGAAGG + Intergenic
1108839786 13:54598224-54598246 GAGGGTGAAAGGTGAGAGGAGGG + Intergenic
1108967077 13:56321868-56321890 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1109317562 13:60768353-60768375 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1109555521 13:63969928-63969950 GAGGGGGAAGGGTGGGAGGCAGG + Intergenic
1109924920 13:69124155-69124177 TTGGGGGAATGGTGGGAGGAGGG + Intergenic
1110209735 13:72957508-72957530 CATGGGGAAGGGTGGGAGCAGGG + Intronic
1110552933 13:76828092-76828114 GAGGGGGAAAGGGGGAAGGAAGG + Intergenic
1110565415 13:76952891-76952913 CAGAGGCCAAGGTGGGCAGACGG + Intronic
1110650663 13:77938143-77938165 CAGGAGGAATGGAGGGTGGAAGG + Intergenic
1111077397 13:83255245-83255267 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1111084272 13:83353002-83353024 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1111814098 13:93128965-93128987 GAGGGTGAAAGGTGTGAGGAGGG - Intergenic
1111988917 13:95095534-95095556 TAGGGGGAAGAGTGGGAGGAGGG + Intronic
1112065577 13:95789299-95789321 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1112372600 13:98807266-98807288 CAGGTGAACAGATGGGCGGATGG - Intronic
1112787403 13:102966392-102966414 GAGGGTGGAAGGTGGGAGGAGGG - Intergenic
1113022190 13:105899790-105899812 GAGGGCGAAGGGTGGGAGGAGGG + Intergenic
1113024293 13:105923210-105923232 AGGGGGGAAAGGGGGGCGGGGGG + Intergenic
1113235466 13:108268206-108268228 CAGGGGAAAGGGTGGGAGGGGGG + Intronic
1113307309 13:109092570-109092592 GAGGGAGAAAGGTGGGAAGAGGG + Intronic
1113409080 13:110068287-110068309 CAGGAGGAAAGGAGGCTGGAAGG - Intergenic
1113510869 13:110853831-110853853 CAGGGGGTAAGGAGGGCGCCTGG + Intergenic
1113988256 13:114336830-114336852 GAGGGGGGAGGGTGGGAGGAGGG + Intergenic
1114134370 14:19830211-19830233 CAGGGGAAAAGGTGGCAAGAAGG - Intergenic
1114519499 14:23324370-23324392 CACGGGGAGGGGTGGGGGGAGGG - Intronic
1114760659 14:25310155-25310177 CAGGGGGAAAGGTAGGAAAAGGG + Intergenic
1114763681 14:25346491-25346513 GAGGGTGGAAGGTGGGAGGAGGG - Intergenic
1114800097 14:25764445-25764467 GAGGGTGAAAGGTGGCAGGAGGG - Intergenic
1114950476 14:27744940-27744962 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1115013273 14:28577013-28577035 CAGGGGGAAAGGTGGGAGGGAGG + Intergenic
1115147219 14:30239566-30239588 TAGGGGGAAAGGAGGAAGGAGGG - Intergenic
1115294039 14:31805752-31805774 GAGGGTGAAGGGTGGGAGGAAGG + Intronic
1115858605 14:37658916-37658938 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1115915416 14:38307130-38307152 CAGGGTGAAGGGAGGGAGGAGGG + Intergenic
1116141847 14:41006037-41006059 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1116185938 14:41600951-41600973 GAGGGTGGAAGGTGGGAGGAGGG + Intergenic
1116223835 14:42122035-42122057 TGGGGGGAAGGGTGGGAGGAAGG + Intergenic
1116348393 14:43827192-43827214 GAGGGTGAAGGGTGGGAGGAAGG - Intergenic
1116406587 14:44573998-44574020 AAGGGGGAAGGCTGGGAGGAGGG + Intergenic
1116674253 14:47885191-47885213 CAGGAGGAAGGGTGGGAGGCAGG - Intergenic
1116720838 14:48493556-48493578 TAGGGTGAAGGGTGGGAGGAAGG + Intergenic
1117180887 14:53190550-53190572 CAAGGGCTAAGGTGGGAGGATGG - Intergenic
1117244383 14:53869608-53869630 GAGGGGGGAAGGTGAGAGGAGGG + Intergenic
1117342194 14:54802045-54802067 CAGGGGAAAGGGTGGGAGGGAGG + Intergenic
1117351284 14:54884296-54884318 TAGGAGGAAAGGTGGAGGGAGGG + Intronic
1117457938 14:55916477-55916499 GAGGGAGAAGGGTGGGAGGAGGG - Intergenic
1117640444 14:57792770-57792792 CAAGGGGAAAGGTGGGAGGGGGG + Intronic
1117785107 14:59275284-59275306 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1118426459 14:65669028-65669050 GAGGGTGAAAGGTGGGAGGAGGG + Intronic
1119432783 14:74579229-74579251 TAGGGGCAAAGGTGCGGGGAAGG - Intronic
1120125058 14:80732054-80732076 CAGGTGGATAGATGGGTGGATGG - Intronic
1120151584 14:81041518-81041540 AAGGGTGGAAGGTGGGAGGAGGG + Intronic
1120193776 14:81462499-81462521 CAGGGCGGCTGGTGGGCGGAGGG + Intergenic
1120251541 14:82065542-82065564 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1120287664 14:82524849-82524871 CAGGGGAAAGGGTGGGAGGGTGG + Intergenic
1120452203 14:84682693-84682715 CAGTGTGGAAGGTGGGAGGAGGG - Intergenic
1120516516 14:85477315-85477337 CCGGGGAGAAGGTGGGTGGAGGG - Intergenic
1120566476 14:86064951-86064973 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1120704995 14:87736547-87736569 CAGGGGGTGTGGTGGGGGGAAGG - Intergenic
1121109664 14:91303617-91303639 CAGGGGGAAAGGTGGGGCCTGGG - Intronic
1121254048 14:92518626-92518648 CAGGGAGAAAGGATGGGGGAAGG + Intronic
1121520480 14:94582948-94582970 CAGTGAGAAAGGTTGGGGGAGGG + Intronic
1121555255 14:94831662-94831684 CAGTGGGAATGGAGGGCAGAAGG + Intergenic
1121676460 14:95757349-95757371 GAGGGGGAAAGGGAGGTGGATGG - Intergenic
1122231438 14:100307980-100308002 CAGGGAGGCAGGTGTGCGGATGG + Intergenic
1122232978 14:100316302-100316324 CAGGGAGAAATGTGGGCAGCAGG + Intergenic
1122398896 14:101455498-101455520 CAGGTGGAAAGAAGGGTGGAAGG + Intergenic
1122507479 14:102240870-102240892 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1122840754 14:104461588-104461610 CAGGGGACAAGGGGGGTGGACGG + Intergenic
1122972489 14:105158080-105158102 CGGGGGGAGAGGTGGGCAAAGGG + Intronic
1123541126 15:21292741-21292763 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1123577427 15:21685802-21685824 CAGGGGAAAAGGTGGCAAGAAGG - Intergenic
1123614050 15:22128272-22128294 CAGGGGAAAAGGTGGCAAGAAGG - Intergenic
1123737214 15:23196957-23196979 GAGGGTGAAAGCTGGGAGGAGGG - Intergenic
1123814007 15:23958093-23958115 CAGGGTGGAAGGTGGGAGGAGGG - Intergenic
1124228258 15:27916193-27916215 GAGGGTGGAAGGTGGGAGGAGGG + Intronic
1124228827 15:27922955-27922977 GAGGATGAAAGGTGGGAGGAGGG - Intronic
1124288430 15:28425619-28425641 GAGGGTGAAAGCTGGGAGGAGGG - Intergenic
1124294794 15:28491695-28491717 GAGGGTGAAAGCTGGGAGGAGGG + Intergenic
1124587623 15:31024324-31024346 CAAGGGATAAGGTGGGAGGATGG - Intronic
1124865770 15:33489351-33489373 GAGGGCGAAAGGTGGGAGGAGGG - Intronic
1124957753 15:34370852-34370874 GAGGGGGAAAGGAGGAGGGAGGG - Intergenic
1125247751 15:37660931-37660953 GAGGGTGGAAGGTGGGAGGAAGG - Intergenic
1125331648 15:38588501-38588523 CAGGGGGGCCGGTGGGTGGAGGG - Intergenic
1125378306 15:39058113-39058135 CAGGGGGAAGGGTGGGAGAGGGG + Intergenic
1125681222 15:41531409-41531431 TAGAGGGAAAGGTGGGCAGGTGG - Intronic
1126151315 15:45526116-45526138 GAAGGGGAAAGGAGGGGGGAAGG - Intergenic
1126151329 15:45526148-45526170 GAAGGGGAAAGGAGGGGGGAAGG - Intergenic
1126151343 15:45526180-45526202 GAAGGGGAAAGGAGGGGGGAAGG - Intergenic
1127558284 15:60109856-60109878 GGGGGGCCAAGGTGGGCGGAGGG + Intergenic
1127995984 15:64153334-64153356 CTGGGGGTAAGGGGGGCCGATGG + Exonic
1128259247 15:66221031-66221053 CAGGGTGAAAGCTGGGTGAAGGG + Intronic
1128456399 15:67833957-67833979 CCGGGAGGAAGGCGGGCGGACGG - Exonic
1128756119 15:70185201-70185223 CAGAGGGGAAGGTGGTGGGAAGG + Intergenic
1129643526 15:77408385-77408407 CAGGGGGAAGGGTGGGAGGGGGG + Intronic
1130443573 15:83978383-83978405 CAGTGGGAGAGGTGGAGGGATGG + Intronic
1130706371 15:86236916-86236938 CACGGGGATATGTGGGCGGGGGG + Intronic
1131447586 15:92512766-92512788 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1131619999 15:94058010-94058032 CAGGGGCAACGGTGGGCAGGAGG + Intergenic
1131948059 15:97649921-97649943 CATTGGGAAAGGTGGCTGGAAGG + Intergenic
1132262864 15:100441534-100441556 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1202949439 15_KI270727v1_random:19882-19904 AAGGGGGAAAGGAGGGAAGAAGG + Intergenic
1202986296 15_KI270727v1_random:420047-420069 CAGGGGAAAAGGTGGCAAGAAGG - Intergenic
1132504514 16:300687-300709 CCGGGGGACAGGTGGGTGGTGGG + Intronic
1132626480 16:894060-894082 CAGGGGGACGGGTGGGCGGATGG - Intronic
1132626494 16:894092-894114 CAGGGGCATGGGTGGGCGGACGG - Intronic
1132626517 16:894155-894177 CAGGGGGACGGGTGGGCGGACGG - Intronic
1132626551 16:894251-894273 CAGGGGGACAGGTGGGCGGACGG - Intronic
1132626585 16:894346-894368 CGGGGGGACAGGTGGGCGGACGG - Intronic
1132626598 16:894378-894400 ACAGGGGACAGGTGGGCGGATGG - Intronic
1132626616 16:894440-894462 CAGGGGGATGGGTGGGCGGACGG - Intronic
1132868209 16:2104174-2104196 CAGGGGGAAAGGGAGGGGAAGGG + Intronic
1133376785 16:5293745-5293767 CTGGGGGAAAGGGGAGGGGATGG + Intergenic
1133564558 16:6981260-6981282 GAGGGTGAATGGTGGGAGGAGGG - Intronic
1134348640 16:13415434-13415456 GAGGGAGGAAGGTGGGAGGAGGG + Intergenic
1134523195 16:14927798-14927820 GAGGGGGAGAGGTGAGGGGAAGG - Intronic
1134719008 16:16370736-16370758 CAGGGGGAAAGGGAGGGGAAGGG - Intergenic
1134774113 16:16837085-16837107 CTGGGGGAAAGGAGAGGGGAGGG + Intergenic
1134955672 16:18381259-18381281 CAGGGGGAAAGGGAGGGGAAGGG + Intergenic
1135025560 16:18996634-18996656 AAGGGGGAATGGAGGGCGGAAGG + Intronic
1135351657 16:21734370-21734392 GAGAGTGAAAGGTGGGAGGAGGG + Intronic
1135628168 16:24014263-24014285 CAGGGGGAGAGGGGTGGGGAGGG + Intronic
1135782549 16:25317193-25317215 GAGGGTGGAAGGTGGGAGGAGGG + Intergenic
1136011670 16:27367404-27367426 GAGGGGGAAAGGGGGGAGGAAGG + Intergenic
1136209420 16:28747102-28747124 CAGGGGCGATGGTGGGCGCAGGG + Intergenic
1136378560 16:29879815-29879837 CAGGGGGCAACGTGGACTGAAGG + Intronic
1136607866 16:31348561-31348583 CAGGTGGATGGGTGGGTGGAGGG + Intergenic
1137002684 16:35243911-35243933 CATGGGGTAAGGTGGGAGGATGG + Intergenic
1137464680 16:48697480-48697502 GAGGGGGTAAGGTGGATGGAGGG + Intergenic
1138058073 16:53857227-53857249 GAGGGTGGAAGGTGGGAGGAGGG - Intronic
1138169139 16:54832420-54832442 CAGGGGTAAGGGTGGGAAGAAGG - Intergenic
1138309297 16:56009499-56009521 CAGGGAGAATGGTGGGCAGTAGG + Intergenic
1138589915 16:57994044-57994066 CAGGAGGAAAGGTGTGCTGGAGG + Intergenic
1138691891 16:58776186-58776208 CAGGGGGTAGGGTAGGGGGAGGG + Intergenic
1138726856 16:59149624-59149646 CAGATGGAAAGCTGGGAGGAGGG + Intergenic
1138808233 16:60118708-60118730 GAGGGTGGAAGGTGGGAGGAGGG - Intergenic
1139061257 16:63254418-63254440 CGGGGGGAAGGGTGGGAGGGGGG + Intergenic
1139307729 16:66001646-66001668 CAGGAGGAAAAGTGAGAGGAGGG + Intergenic
1139416417 16:66814859-66814881 AAGGGGGAAAAGTGGTAGGAAGG - Intronic
1139527127 16:67523915-67523937 CGGGAGGCAAGGTGGGAGGATGG - Intronic
1140829407 16:78737581-78737603 CAGGGAGAAGGGTGGGAGTAGGG - Intronic
1140947661 16:79784934-79784956 GAGGGTGGAAGGTGGGAGGAGGG + Intergenic
1141225982 16:82115250-82115272 CAGGGGAAAAGGTGGGAGGGAGG - Intergenic
1141244868 16:82296487-82296509 CAGGGGAAAGTGTGGGAGGAGGG - Intergenic
1141253812 16:82382555-82382577 CAGGTGGAAAGGTGAGAGGCAGG + Intergenic
1141289325 16:82703297-82703319 CAGAAGGAATGGTGGGGGGACGG - Intronic
1141812483 16:86384881-86384903 GAGGGTGGAAGGTGGGAGGAGGG - Intergenic
1141943534 16:87294445-87294467 CAGATGGATAGGTGGGTGGATGG + Intronic
1142354904 16:89597729-89597751 CAGGGCGATGGGTGGACGGATGG - Intergenic
1142354914 16:89597757-89597779 CGGGGGGATGGGTGGACGGATGG - Intergenic
1142354927 16:89597785-89597807 CGGGGGGATGGGTGGACGGATGG - Intergenic
1142355091 16:89598224-89598246 CGGGGGGATGGGTGGGCGGATGG - Intergenic
1143513485 17:7408126-7408148 CGGGGGGAAAGGAGGGAGGAGGG - Intronic
1144044293 17:11440936-11440958 CAAGAGGAAAGGAGGGAGGAAGG + Intronic
1144196951 17:12903743-12903765 CAGGGGAAAGGGTGGGAGGAGGG - Intronic
1144230669 17:13199938-13199960 CTAGTGGAAAGGAGGGCGGAAGG - Intergenic
1144266084 17:13571110-13571132 AAGGGAGAAAGGTGGGAGGAAGG + Intronic
1144432466 17:15206769-15206791 CAGGGGGTGGGGTGGGAGGAAGG + Intergenic
1144967989 17:19089630-19089652 CCTGGGGAAAGGTAGGTGGAGGG + Intergenic
1144979928 17:19162433-19162455 CCTGGGGAAAGGTAGGTGGAGGG - Intergenic
1144988294 17:19215799-19215821 CCTGGGGAAAGGTAGGTGGAGGG + Intronic
1145065651 17:19759740-19759762 CAGGGGGCAGGGAGGGCAGAGGG - Intergenic
1146372878 17:32276164-32276186 CAGGGGAAAAGGTCAGGGGAAGG + Intronic
1146459788 17:33036952-33036974 GAGGGAGAAGGGTGGGAGGAGGG + Intronic
1146614572 17:34344630-34344652 AAGGGGGAAGGGTGGAAGGAGGG + Intergenic
1146824884 17:36013551-36013573 CAGGGGGAAAAGGGTGGGGAAGG - Intronic
1146834682 17:36100800-36100822 AAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1146849290 17:36207985-36208007 AAGGGTGAAGGGTGGGAGGAGGG - Intronic
1146918360 17:36692610-36692632 TGGGGGGAAGGGTGGGAGGAAGG - Intergenic
1147352442 17:39860720-39860742 AATGGGGAAGGGTGGGAGGAGGG + Intronic
1147504426 17:41001478-41001500 GAGGGTGGAAGGTGGGAGGAGGG + Intergenic
1147534081 17:41307189-41307211 CAGAGGGATGGGTGGGTGGATGG + Intergenic
1147605938 17:41773673-41773695 CAGGGGCAATGGTGGGGGGCGGG + Intronic
1147609709 17:41794223-41794245 CAGGGGGAGGGGTGGGTGCATGG + Intergenic
1147807117 17:43139682-43139704 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1147969297 17:44211027-44211049 AAGGGGGCAAGGTGGGCAGAGGG - Exonic
1148059855 17:44829472-44829494 AAGCGGGAAAGCGGGGCGGAAGG - Intronic
1148105244 17:45115293-45115315 AGGGGGGGAAGGTGGGAGGACGG - Intronic
1148533109 17:48414308-48414330 CTGGGGGAAAGGTGGGAAGTTGG + Intronic
1148618191 17:49015380-49015402 CCGAGGGAAAGGTGGGGGGCAGG - Intronic
1148618430 17:49016795-49016817 CAGGAGGACAGGGGGGCGGGCGG - Intronic
1148976122 17:51530434-51530456 CAGGGGGAAGGATGAGAGGAGGG + Intergenic
1149349966 17:55776460-55776482 TACGGGGATGGGTGGGCGGAGGG + Exonic
1149392896 17:56209814-56209836 CAGGGGAAAAGGTGGGAGAGGGG - Intronic
1149399760 17:56283734-56283756 CAGGGGAAAGGGTGGGAGGGGGG + Intronic
1149710352 17:58736162-58736184 AAGGGTGGAAGGTGGGAGGAAGG - Intergenic
1150175330 17:63048798-63048820 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1150210493 17:63438714-63438736 CAGGAGGAAAGGAGAGCGGGTGG + Intronic
1150431124 17:65118291-65118313 CTGGGGGAAGGGTGGGAGGGGGG - Intergenic
1150606404 17:66695004-66695026 GAAGGGGAAAGGTGAGGGGAAGG + Intronic
1150873682 17:68944592-68944614 CAGGAGTAAAGGTTGGGGGAAGG - Intronic
1150875624 17:68967169-68967191 AAGGGGGAAAGGTGGGAAGGGGG - Intergenic
1151143923 17:72021154-72021176 GAGGGTGGAAGGTGGGAGGAGGG - Intergenic
1151443133 17:74146558-74146580 CAGGGGAAATGGTGGGGGCAGGG - Intergenic
1151538723 17:74753321-74753343 CAGGGAGCAAGGTGGGTGGTGGG + Intronic
1152045180 17:77930676-77930698 CAGGGGGGAAGCTGGGACGAAGG - Intergenic
1153033342 18:735489-735511 AAGGGGGAAAGGTTGGGGGGTGG + Intronic
1153078421 18:1192598-1192620 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1153158026 18:2171188-2171210 GAGGGGGAAGGGTGGGAGGAGGG - Intergenic
1153162005 18:2216914-2216936 CAGGGCAGAAGGTGGGAGGAGGG + Intergenic
1153358136 18:4161228-4161250 CCTGGGGAAAGGTGGCGGGAGGG - Intronic
1153564268 18:6404091-6404113 TGGGGGGAAGGGTGGGAGGAGGG + Intronic
1153679677 18:7488716-7488738 CAGGTGGGAAGGTGGGAGGGTGG - Intergenic
1153836750 18:8970484-8970506 GAGGGGGAAGGGAGGGAGGAAGG + Intergenic
1153900704 18:9614739-9614761 CAGCGGGAAAGGCGGGAGGCGGG - Intronic
1155028041 18:21960189-21960211 AAGGGGGAAAGGGGTGGGGAAGG - Intergenic
1155085120 18:22451164-22451186 GAGGGGGGAGGGTGGGAGGAGGG + Intergenic
1155182023 18:23356199-23356221 CAAGGGGAAAGCTGAGCGGGTGG + Intronic
1155494944 18:26433576-26433598 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1155513892 18:26604737-26604759 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1155531364 18:26770328-26770350 CAGGGGCTAAGGTGGGGGGAGGG - Intergenic
1155643042 18:28043299-28043321 CACGGGGAAGGGTGGGAGGCGGG + Intronic
1155741556 18:29295324-29295346 GAGGGTGAAAGGTGGGAGGAGGG + Intergenic
1155770800 18:29695769-29695791 GAGGGTGGAAGGTGGGAGGAGGG - Intergenic
1156278088 18:35604069-35604091 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1156466933 18:37353642-37353664 CTGGGGGAAAGGTGGGGGACTGG + Intronic
1156495670 18:37523845-37523867 CAGAGGTGAAGGTGGGAGGAGGG + Intronic
1156651960 18:39235583-39235605 CAGGGAGGAAGGTGGGCTGCAGG - Intergenic
1157702387 18:49770395-49770417 CTGGGGAAAAGGTGGGAGGGGGG - Intergenic
1158031848 18:52975502-52975524 GAGGGTGGAAGGTGGGAGGAGGG - Intronic
1158078433 18:53560061-53560083 GAGGGGGAAAAGAGGGCGGGAGG + Intergenic
1158706562 18:59797678-59797700 GAGGGTGGAAGGTGGGAGGAGGG - Intergenic
1158839587 18:61369912-61369934 GAGGGTGGAAGGTGGGAGGAGGG + Intronic
1159052743 18:63436690-63436712 CAGGGGCCAAGGTGGGTGGCAGG + Intergenic
1159386987 18:67739971-67739993 GAGGGTGGAAGGTGGGAGGAGGG - Intergenic
1159453564 18:68633036-68633058 CAGGGGAAAGGGTGGGAGGAGGG - Intergenic
1160150299 18:76392844-76392866 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150308 18:76392867-76392889 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150317 18:76392890-76392912 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150327 18:76392913-76392935 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150336 18:76392936-76392958 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150345 18:76392959-76392981 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150355 18:76392982-76393004 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150364 18:76393005-76393027 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150373 18:76393028-76393050 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150382 18:76393051-76393073 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150392 18:76393074-76393096 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150402 18:76393097-76393119 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150411 18:76393120-76393142 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150420 18:76393143-76393165 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150449 18:76393212-76393234 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150466 18:76393263-76393285 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150475 18:76393286-76393308 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150485 18:76393309-76393331 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150494 18:76393332-76393354 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150504 18:76393355-76393377 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150513 18:76393378-76393400 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150522 18:76393401-76393423 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150560 18:76393498-76393520 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150608 18:76393613-76393635 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150636 18:76393682-76393704 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150645 18:76393705-76393727 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150673 18:76393774-76393796 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150682 18:76393797-76393819 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150719 18:76393894-76393916 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150728 18:76393917-76393939 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150738 18:76393940-76393962 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150747 18:76393963-76393985 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150764 18:76394001-76394023 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150773 18:76394024-76394046 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150782 18:76394047-76394069 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150820 18:76394144-76394166 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150857 18:76394241-76394263 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150866 18:76394264-76394286 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150876 18:76394287-76394309 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150885 18:76394310-76394332 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150895 18:76394333-76394355 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150904 18:76394356-76394378 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150914 18:76394379-76394401 CAGGTGGTCAGGTGGGGGGAGGG + Intronic
1160150923 18:76394402-76394424 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150932 18:76394425-76394447 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150970 18:76394522-76394544 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160150998 18:76394591-76394613 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160151026 18:76394660-76394682 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160151035 18:76394683-76394705 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160151064 18:76394752-76394774 CAGGTGGTCAGGTGGGGGGAAGG + Intronic
1160383636 18:78479704-78479726 CAGAGGGCACGGTGGGCGGAGGG - Intergenic
1160719876 19:592364-592386 CTGGGGGGCAGGTGGGCAGATGG + Intronic
1160919228 19:1512083-1512105 CAGGGGGAAAGAGGGGGGAAGGG + Intronic
1161114408 19:2488835-2488857 CAGGGGGTGAGGTGGAAGGAAGG - Intergenic
1161347709 19:3776441-3776463 CAGGGGGATGGGTGGGTGGGTGG + Intergenic
1161573898 19:5045129-5045151 CAGTGGGACAGGTGGGCGGGAGG - Intronic
1161711828 19:5853036-5853058 AAGGGGGAATGGAGGGCGGAAGG - Intergenic
1161779613 19:6282744-6282766 CAGGGGGTGTGGTGGGGGGAGGG + Intergenic
1161793618 19:6374630-6374652 CAGGGCACAGGGTGGGCGGATGG - Intronic
1161958069 19:7507136-7507158 CAGCGGGTAAGGGAGGCGGAGGG + Exonic
1162289896 19:9771120-9771142 CTGGGGGAAGGGTGGGAGAAGGG - Intronic
1162388923 19:10377783-10377805 TAGGTGGATAGGTGGGTGGATGG + Intronic
1163004545 19:14389229-14389251 AAGGGGGAAAGGGAGGGGGATGG + Intronic
1163312178 19:16521237-16521259 CACTGGGAAGGGTGGGCTGAGGG + Exonic
1163675413 19:18653382-18653404 CAGGTGGGTGGGTGGGCGGATGG - Intronic
1163675431 19:18653440-18653462 CAGGTGGATGGGTGGGTGGATGG - Intronic
1163675649 19:18654103-18654125 CAGGTGGATGGGTGGGTGGATGG - Intronic
1163675719 19:18654369-18654391 CAGGTGGATGGGTGGGCAGATGG - Intronic
1164202644 19:23031268-23031290 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1164258613 19:23550495-23550517 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1164553662 19:29233327-29233349 CGGGAGGCAAGGTGGGAGGATGG - Intergenic
1164751589 19:30659293-30659315 CAGGAGGAAAGGAGGGAGGTGGG + Intronic
1165392629 19:35547180-35547202 CAGGAGGACAGCTGGCCGGAAGG - Exonic
1165830570 19:38728446-38728468 GAGGGGGAGAGGTGGGGGGGAGG - Intronic
1165873412 19:38989224-38989246 CAGGAGGAAAGCTGGCCGAAGGG - Intergenic
1166072434 19:40395011-40395033 CAGGAGGAAGGGAGGGCAGAGGG - Exonic
1166379417 19:42348045-42348067 CAGGGGTAAAGGTGGGCTCTGGG + Intronic
1166387514 19:42390435-42390457 CAGGAGGAGAAGTGGGGGGATGG - Intergenic
1166607629 19:44159280-44159302 CAGAGGGAGAGATGGGCAGATGG - Exonic
1167044733 19:47042911-47042933 CAGGGGCCAAGGTGGGAGGTGGG - Intronic
1167293272 19:48635875-48635897 CTGGGGCAGTGGTGGGCGGAGGG - Exonic
1167598210 19:50438339-50438361 CAGGTGGGAAGGTGGGTGGATGG + Intronic
1167599053 19:50443216-50443238 CAGGGGCTGAGGTGGGAGGATGG + Intronic
1167786475 19:51641791-51641813 AAGGGTGGAAGGTGGGAGGAGGG + Intronic
1167842552 19:52133866-52133888 CAGGGTGGAGGGTGGGAGGAGGG - Intronic
1168183379 19:54679282-54679304 AGGGGGGAAGGGTGGGAGGAGGG + Intronic
1168449775 19:56457337-56457359 CAGGGGGACAGGTGGGCATAAGG + Intronic
1168464978 19:56594981-56595003 CAGGAGGGAAGGGGGGAGGAGGG - Intergenic
1168479890 19:56710988-56711010 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
924989031 2:295436-295458 CATGGGGGAGGGTGGGCAGAAGG - Intergenic
925093671 2:1176299-1176321 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
925577896 2:5379729-5379751 GAGGGTGAAAGGTGGGAGGAGGG + Intergenic
925755310 2:7127936-7127958 GAGGGGGAAAGGGGAGGGGAGGG - Intergenic
925961721 2:9023399-9023421 CAGGGAGAAGGGTGGGAGGGGGG + Intergenic
926084710 2:10013168-10013190 CAGGTGGACAGGTGTGCGTATGG + Intergenic
926085289 2:10016080-10016102 CAGGTGGACAGGTGTGCGTATGG + Intergenic
926459276 2:13108985-13109007 CAGGGGAAAAGGTGGGAGAAGGG + Intergenic
926595246 2:14782956-14782978 GAGGGTGGAAGGTGGGAGGAGGG + Intergenic
927154983 2:20216229-20216251 CAGGGAGGAAGGTGGGGGGCAGG + Intronic
927492433 2:23529550-23529572 CAGGGGCTGAGGTGGGGGGAAGG - Intronic
927596618 2:24403140-24403162 GCGGGGGAAAGGCGGGCGGGGGG - Intergenic
927875567 2:26653172-26653194 CAGGAGGAAGGGTGGTCAGATGG - Intergenic
928025561 2:27736088-27736110 GAGGGGGAAAGGTGGGGAGCAGG - Intergenic
928181114 2:29069534-29069556 GAGGGTGGAAGGTGGGAGGAGGG + Intronic
928218573 2:29383146-29383168 GAGAGGGAAGGGTGGGAGGAGGG - Intronic
928668859 2:33579858-33579880 AAGGGGGAAAGGTGGGCTGGGGG - Intergenic
928763433 2:34611749-34611771 CTGGGGGAAAGATAGACGGAAGG + Intergenic
929032861 2:37664909-37664931 GAGGGGGAAGGGCGGGAGGAGGG + Intronic
929370227 2:41214476-41214498 CAGGGGGAAGGGTGGGAGAGTGG - Intergenic
929444475 2:41991890-41991912 AAGGGGGAAAGGAGGGAGAAGGG + Intergenic
929757491 2:44779315-44779337 CATGGTGAAAGCTGGGCGGTGGG + Intergenic
929804977 2:45136985-45137007 GAGGGAGGAAGGTGGGAGGAGGG - Intergenic
929928260 2:46232840-46232862 CAGGGTGAAATGGGGGTGGAGGG - Intergenic
931493076 2:62771010-62771032 AAGGGTGAAGGGTGGGAGGAGGG + Intronic
931546585 2:63394886-63394908 GAGGGTGAAGGGTGGGAGGATGG + Intronic
931751016 2:65329971-65329993 CAGGGGCAAAGGTGGAAGCAGGG - Intronic
931857056 2:66313933-66313955 AAGGGGGTGAGGTGGGGGGAGGG - Intergenic
932243341 2:70175336-70175358 GAGGGTGAAACGTGGGAGGAGGG - Intronic
932449489 2:71800491-71800513 CAGTGGGAAGGCTGGGCAGATGG - Intergenic
932568757 2:72925584-72925606 TAGGAGGAAAGGGGAGCGGAAGG - Intronic
932913543 2:75830584-75830606 CAGGGAGAAAGGTGGGTTAAAGG + Intergenic
933273205 2:80255903-80255925 CAGAGGGAAGGGTGGCAGGAAGG - Intronic
933278171 2:80304400-80304422 CAGAGGGAAAGGAAGGCGGCAGG - Exonic
933355483 2:81205252-81205274 GAGGGGAAAGGGTGGGAGGACGG - Intergenic
933812626 2:86042593-86042615 CAGAGGGAAAGGCAGGAGGAAGG + Intronic
934578985 2:95423221-95423243 CGGGGGAAAGGGTGGGAGGAGGG + Intergenic
934600462 2:95653482-95653504 CGGGGGAAAGGGTGGGAGGAGGG - Intergenic
934766257 2:96881734-96881756 CAGGGGGCAGGGAGGGGGGAGGG + Intronic
935101326 2:99998482-99998504 ATGGGGGAGAGGTGGGCAGAGGG + Intronic
935339202 2:102044841-102044863 CAGGGGGAAGAGTGGGAGGGTGG + Intergenic
935418651 2:102844334-102844356 CAGGGCCAAAGGTGGCTGGAGGG + Intergenic
935421079 2:102869490-102869512 GAAGGGGAAAGGTGGGCCAAAGG + Intergenic
935427772 2:102938521-102938543 CAGGAGGAAAGGAGAGAGGAGGG + Intergenic
935785838 2:106548084-106548106 GAGGGGGAAAGGTGGGACGAGGG - Intergenic
936125982 2:109789593-109789615 CACGGTGAAAGGTGGGGAGAGGG + Intergenic
936218711 2:110581875-110581897 CACGGTGAAAGGTGGGGAGAGGG - Intergenic
936533820 2:113295543-113295565 CGGGGGAAAGGGTGGGAGGAGGG - Intergenic
936690678 2:114884704-114884726 TTGGGGGAAGGGTGGGAGGAGGG - Intronic
936783937 2:116069427-116069449 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
937072251 2:119073266-119073288 AAGAAGGAAAGGTGGGAGGAAGG + Intergenic
937094832 2:119228621-119228643 CAGGGTGATGGGTGGGTGGAGGG + Intronic
937271409 2:120655162-120655184 GAGGGGCAGAGGTGGGCGAATGG - Intergenic
937350372 2:121156634-121156656 CAGGAGGAAAGGGGCTCGGAGGG - Intergenic
937684787 2:124683531-124683553 CAAGGGGAAGGGTGGGAGGCAGG - Intronic
937772954 2:125743601-125743623 CAAGGGGAAGGGTGGGAGGGGGG - Intergenic
937970791 2:127547128-127547150 TAGGTGGAAGGGTGGGCTGATGG - Intronic
938285882 2:130116494-130116516 CAGGGTGAAGGGTGGGAGGAGGG - Intronic
938388484 2:130885050-130885072 CAGGGAGAAAGGTGGAAGTATGG - Intronic
938429723 2:131222408-131222430 CAGGGTGAAGGGTGGGAGGAGGG + Intronic
939216940 2:139250648-139250670 CAGGGGGTGTGGTGGGGGGAGGG + Intergenic
939299691 2:140319621-140319643 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
939639029 2:144617205-144617227 CAGGGGGTGTGGTGGGGGGAGGG - Intergenic
940141769 2:150499376-150499398 CAGGGGAAAGGGTGGGAGGCAGG - Intronic
940354029 2:152718721-152718743 CAGGGGGACAGCTGGGGTGAAGG + Exonic
940366500 2:152853863-152853885 GAGGGAGAAGGGTGGGAGGACGG - Intergenic
940579493 2:155559590-155559612 GAGGGTGAAAGGTAGGTGGAGGG + Intergenic
940685484 2:156844937-156844959 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
940862064 2:158781061-158781083 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
941497131 2:166219569-166219591 GAGGGTGAAGGGTGGGAGGAAGG + Intronic
941541396 2:166790142-166790164 GAGGGGGGAAGGTGGGAAGAGGG - Intergenic
941583699 2:167331360-167331382 CAGTGGGCTGGGTGGGCGGATGG + Intergenic
942846765 2:180436044-180436066 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
942911840 2:181253259-181253281 GAGGGGGAAGGGTGGACTGAAGG - Intergenic
942917585 2:181330206-181330228 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
943350475 2:186791300-186791322 CAGGGGGAGGGGTGGGGGAAGGG + Intergenic
943395988 2:187335117-187335139 AAGGTGGGAAGGTGGGAGGAAGG + Intergenic
943702964 2:191006117-191006139 CAGGAGCAAAGATGGGCAGAAGG - Intronic
943950273 2:194125538-194125560 TAGGGTGAAGGGTGGGTGGAGGG - Intergenic
943972821 2:194432581-194432603 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
944261818 2:197686191-197686213 GTGGGGGAAAGGTGGGAGGTGGG - Intergenic
944293069 2:198030149-198030171 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
944910299 2:204304518-204304540 CAGGAGGAAGGGTGGGCCGATGG - Intergenic
945323752 2:208458590-208458612 GAGGGGGGAAGGTAGGAGGAGGG - Intronic
946097646 2:217289533-217289555 CATGGGGAAAGGGTGGAGGACGG + Intronic
946149793 2:217756659-217756681 CAGGGGAAGGGGTGGGCGCAGGG - Intergenic
946218843 2:218208777-218208799 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
946422599 2:219572943-219572965 TAGGAGGAAAGGTGGCAGGAAGG - Intronic
946785051 2:223234944-223234966 AGGGGGGAAAGGTGGGGAGAAGG - Intergenic
946853195 2:223927925-223927947 AAGGGGGAAAGGAGGGAGGCAGG + Intronic
946973688 2:225123408-225123430 AAGGAGGAAAGATGGGAGGAAGG - Intergenic
947438463 2:230094501-230094523 CAGGGGAAAGGGTGGGAGGGAGG - Intergenic
947885447 2:233566159-233566181 GAGGGGGGAAGGGGAGCGGAGGG + Intronic
947953155 2:234165199-234165221 GAGGGTGGAGGGTGGGCGGAGGG - Intergenic
947957746 2:234208739-234208761 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
948028457 2:234797538-234797560 CAGGGAGAGAGGTGTGTGGATGG + Intergenic
948358227 2:237397517-237397539 AAGGTGGGAAGGTGGGAGGAAGG + Intronic
948577232 2:238962504-238962526 CAGGCAGAAGGGTGGGCGGGCGG + Intergenic
948757992 2:240170154-240170176 CAGGAGCAAAGGTGGGGGGGGGG + Intergenic
948822163 2:240555540-240555562 CAGGTGGATAGGTGGACAGATGG + Intronic
949069563 2:242015943-242015965 CAGAGGGAAGGGTGTGGGGAGGG + Intergenic
1168821443 20:776036-776058 CTCGGGGAAAGGCAGGCGGAGGG + Intergenic
1169300231 20:4435876-4435898 TAGGGAGAGGGGTGGGCGGATGG + Intergenic
1169505724 20:6209214-6209236 AAGAGGGAAAGGAGGGAGGAAGG - Intergenic
1169928924 20:10811250-10811272 TTGGGGGAGAGGTGGGGGGAAGG - Intergenic
1170050198 20:12134485-12134507 CAGGGGGAAGGGTGGTAGGAGGG - Intergenic
1170435795 20:16327285-16327307 CAGGGGAAAGGGTGGGAGGGGGG + Intronic
1170767744 20:19305235-19305257 CATGAGGAAATGTGGGAGGATGG + Intronic
1171062037 20:21974366-21974388 CAGTGGGAAGGATGGGAGGAGGG - Intergenic
1171779097 20:29402529-29402551 GAGGGGGGAAGGTGGGAAGAGGG + Intergenic
1172205560 20:33160611-33160633 CAATGGAAAAGGTGGGGGGAGGG - Intergenic
1172497492 20:35398741-35398763 CAGGGCCAAAGGTGGGGGGGGGG + Intronic
1172623853 20:36336422-36336444 CAGGGAGAAGGGTGAGAGGAGGG - Intronic
1172947331 20:38699683-38699705 CAGGTGGACAGGTGGGGGCAAGG + Intergenic
1173369561 20:42423044-42423066 GAGGGTGGAAGGTGGGAGGAGGG + Intronic
1173427901 20:42958444-42958466 GAGGAGGAAAGGAGGGGGGAGGG + Intronic
1173575874 20:44112775-44112797 CAGGGGGCAGGGTGGGAAGAGGG - Exonic
1173618273 20:44416910-44416932 AAGGAGAAAAGGTGGGAGGAAGG - Intronic
1173663858 20:44751946-44751968 ATGAGGGAAAGGTGGGTGGATGG + Exonic
1173930096 20:46811201-46811223 GAGGGGGAAAGGTGGGGGCGAGG - Intergenic
1174069262 20:47888462-47888484 CCCGGGGGAAGGTGGGTGGAAGG - Intergenic
1174296698 20:49550375-49550397 AAGGGGGAAAAGTGGGCTGGAGG - Intronic
1174550299 20:51357129-51357151 AAGGGTGAAAGGTGGGGTGATGG + Intergenic
1174550506 20:51358193-51358215 CAGGTGGAATGGTGGATGGATGG + Intergenic
1174793697 20:53503811-53503833 CAGGGAGGAAGGAGGGAGGAAGG + Intergenic
1174855029 20:54036052-54036074 GAGGGTGGAAGGTGGGAGGAGGG + Intronic
1175292512 20:57886004-57886026 CGGGGGGAAGGGTGGGAGGAGGG - Intergenic
1175335847 20:58195905-58195927 GATGGGGAAAGGTGGGTGGGTGG - Intergenic
1175565546 20:59973539-59973561 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1175667702 20:60874194-60874216 CAGGGAACAGGGTGGGCGGAAGG + Intergenic
1175903505 20:62369000-62369022 CAGGGGGAGAGGTGGGGGTGGGG + Intergenic
1175904958 20:62375203-62375225 AAGGCTGAAAGGTGGGAGGATGG + Intergenic
1176075975 20:63248391-63248413 CCAGGGGAAACGTGGGGGGAGGG - Intronic
1176138358 20:63534783-63534805 GAGCGGGCCAGGTGGGCGGAGGG + Intronic
1176139487 20:63538709-63538731 CAGGGGGAGGGGTGGGGGGTGGG + Intergenic
1176162234 20:63653682-63653704 CAGGGGGAGAGGGCGGAGGAGGG + Intergenic
1176173455 20:63706962-63706984 CCGTGGGAAAGGTGCGCGCAAGG + Intronic
1176512926 21:7762172-7762194 CATCGGGAAAGGTGGGAGGAGGG + Intronic
1176550145 21:8217329-8217351 AGGGGGGAACGGGGGGCGGACGG - Intergenic
1176569073 21:8400364-8400386 AGGGGGGAACGGGGGGCGGACGG - Intergenic
1176576987 21:8444599-8444621 AGGGGGGAACGGGGGGCGGACGG - Intergenic
1176664831 21:9675971-9675993 CTGGGGGACCGGTGGCCGGAGGG - Intergenic
1177419268 21:20835041-20835063 GAGGGTGGAAGGTGGGAGGAGGG - Intergenic
1177679190 21:24341821-24341843 GATGGGGGAAGGTGGGAGGATGG + Intergenic
1177785585 21:25667940-25667962 GAAGGGGAAAGGTGAGCTGAAGG + Intronic
1178297891 21:31426168-31426190 CAGGAGGAAGGGTGGGAGGTGGG - Intronic
1178414518 21:32393061-32393083 CTCGGGGAAAGGCCGGCGGAAGG + Intergenic
1178636096 21:34305356-34305378 CTGGGGGAAAGGGTGGCTGAGGG + Intergenic
1178647039 21:34392696-34392718 CATCGGGAAAGGTGGGAGGAGGG + Intronic
1179775584 21:43659784-43659806 GAGGGAGACAGGTGGGCGCACGG + Exonic
1180049400 21:45324434-45324456 GAGGGGGTAAGGTGGGGTGAAGG + Intergenic
1180157873 21:45986793-45986815 CAGGGGCAAGGGTGGCCGGCTGG - Intronic
1180913522 22:19469786-19469808 CAGGGGAAGAGGTGGCCTGATGG + Intronic
1181081628 22:20419471-20419493 GAGTGGGAAGGGTGGGAGGAAGG - Intergenic
1181126401 22:20704285-20704307 CAGGGCGAAAGGCGGGCAGGTGG - Intergenic
1181338295 22:22157801-22157823 TAGAGAGAAAGGTGGGTGGAGGG + Intergenic
1181615248 22:24049827-24049849 CAGGTGGAGAGGTGGGAAGATGG - Intronic
1181762446 22:25067595-25067617 GAGGGAGGAAGGTGGGAGGAAGG - Intronic
1181822639 22:25487633-25487655 CGGGTGGAAGGGTGGGTGGATGG + Intergenic
1182513678 22:30838977-30838999 AGGGGGGAAGGGTGGGGGGAGGG - Intronic
1182710737 22:32321609-32321631 AAGGGCGGAAGGTGGGAGGAGGG - Intergenic
1182787988 22:32923835-32923857 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1182970721 22:34573607-34573629 TAGGGGAAAAGGTGGGAGGGGGG - Intergenic
1183303599 22:37070472-37070494 CAGGAGGACAGGTGAGCGGGAGG - Exonic
1183307802 22:37092220-37092242 CAGGGGCAAAGGCTGGGGGAGGG - Intronic
1183313540 22:37124748-37124770 AAGGAGGAGAGGTGGGGGGAGGG - Intergenic
1183390789 22:37544815-37544837 CATGTTGACAGGTGGGCGGAAGG - Intergenic
1183432431 22:37773818-37773840 CAGGAGGGAAGGAGGGCGGCTGG - Exonic
1183547085 22:38460170-38460192 CAGCGGGAAAGGTTGGCGGAGGG - Intergenic
1183660887 22:39220544-39220566 CAGGTGGACAGGTGGATGGATGG + Intergenic
1183660918 22:39220688-39220710 CAGGTGGACAGGTAGACGGATGG + Intergenic
1183731264 22:39619911-39619933 CAGGTGGATAGGTGGACGGGTGG - Intronic
1183734127 22:39634538-39634560 GAGGGGAAAAGGTGGAGGGATGG - Intronic
1184016727 22:41791518-41791540 CAGTGGGAAAGATGGGGGCAAGG + Intronic
1184128145 22:42501802-42501824 CAGGGGGAAAGTGGGCAGGAAGG + Intergenic
1184136935 22:42555115-42555137 CAGGGGGAAAGTGGGCAGGAAGG + Intronic
1184177605 22:42797866-42797888 CAGGGAGCAAAGTGGGCGGGAGG + Intronic
1184254695 22:43280425-43280447 CAGGGGGATGGGTGAGGGGAAGG - Intronic
1184544589 22:45158237-45158259 GAGGTGGAGAGGTGGGGGGAGGG - Intergenic
1184778377 22:46634473-46634495 CAGGAGCAAGGGTGGGCGAATGG + Intronic
1184900831 22:47445483-47445505 CAGGAGGATAGGTGGACAGAAGG - Intergenic
1184900855 22:47445611-47445633 CAGGAGGATAGGTGGACAGAAGG - Intergenic
1185191245 22:49437947-49437969 CATAGTGAAAGGTGGGAGGAAGG - Intronic
1185192852 22:49449872-49449894 CTGGGCGAGAGGTGGACGGATGG - Intronic
1203255038 22_KI270733v1_random:133661-133683 AGGGGGGAACGGGGGGCGGACGG - Intergenic
1203263094 22_KI270733v1_random:178740-178762 AGGGGGGAACGGGGGGCGGACGG - Intergenic
949433111 3:3999694-3999716 GAGTGGGAAAGGTGGGAGGAGGG + Intronic
949457093 3:4250266-4250288 GAGGGGGAAAGGGGGAAGGAAGG + Intronic
949494526 3:4619537-4619559 AAGGGGGAAAGGGCGGCAGAAGG - Intronic
950113548 3:10435643-10435665 CAGGGTGACAGGTGGGCAGGAGG + Intronic
950237709 3:11338100-11338122 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
950475070 3:13209909-13209931 CAATGGGAAAGGTTGGAGGATGG - Intergenic
950564270 3:13757171-13757193 GAGGGTGGAAGGTGGGAGGAAGG - Intergenic
950723006 3:14898135-14898157 CAGGGGTTGAGGTGGGCGAAGGG + Intronic
950852366 3:16074672-16074694 GAGGGTGGAAGGTGGGAGGATGG + Intergenic
950853503 3:16084644-16084666 AAGGGTGAAGGGTGGGAGGAGGG - Intergenic
950947693 3:16966914-16966936 CAGGGTGGAGGGTGGGAGGAGGG - Intronic
951079738 3:18438826-18438848 CTGGGGGAAAGGGGTGCGGGGGG + Intronic
951161087 3:19423430-19423452 CAGGGGGAAGGGTGGAAGGAGGG - Intronic
951275724 3:20683250-20683272 GAGGGTGAAATGTGGGAGGAGGG + Intergenic
951968864 3:28420448-28420470 GAGGGTGGAAGGTGGGAGGAGGG - Intronic
953039100 3:39238995-39239017 GAGGGAGAAAGGTGGGAAGAGGG - Intergenic
953039194 3:39239735-39239757 GAGGGTGAAGGGTGGGAGGAAGG - Intergenic
953312001 3:41889535-41889557 CAGGGTGGAGGGTGGGAGGAGGG + Intronic
953983358 3:47423904-47423926 CAGTGGGAGAGTTGGGCAGAGGG - Intronic
954411795 3:50374202-50374224 GAGGGGGGAAGGTGAGGGGAGGG + Intronic
954544322 3:51419877-51419899 GAGGGAGAAAGGTGGGCAGGTGG + Exonic
955117638 3:56021714-56021736 GAGTGGGGAAGGTGGGAGGAGGG - Intronic
955140285 3:56261854-56261876 GAGGGTGGAAGGTGGGAGGAGGG - Intronic
955141209 3:56271751-56271773 GAGGGTGGAAGGTGGGAGGAGGG - Intronic
955234592 3:57128530-57128552 CGGGGGGCAAAGTGGGTGGAGGG - Intronic
955533261 3:59897039-59897061 CAGTTGGAAAGGTGGGTGGGAGG - Intronic
956015621 3:64879679-64879701 TAGGGGGAAGGGTGGGAGGGGGG + Intergenic
956373826 3:68592675-68592697 CAGGGAGTAAGGTGGGGGGAGGG - Intergenic
956913874 3:73850456-73850478 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
956915898 3:73870438-73870460 GAGGGTGGAAGGTGGGAGGAGGG + Intergenic
957086046 3:75678138-75678160 AGGGGGGGAAGGTGGGAGGAGGG - Intergenic
958661925 3:97079447-97079469 GAGGGTGGAAGGTGGGAGGAGGG + Intronic
958789749 3:98637866-98637888 CAGGGGGAAGGGTGGGAGTGGGG - Intergenic
959098434 3:101983005-101983027 GAGGGTGGAAGGTGGGAGGAGGG - Intergenic
959318339 3:104838129-104838151 GAGGGTGAAGGGTGGGAGGAAGG + Intergenic
959443459 3:106408003-106408025 AAGGGGGAAAAGTGGGTAGAAGG - Intergenic
959543854 3:107571123-107571145 AAGGGGGAATGGAGGGTGGAAGG + Intronic
959875735 3:111380081-111380103 CAGGGGGAAAGGACGGCTGTGGG + Intronic
960225136 3:115159271-115159293 CAGGGAGAGGGGTGGGAGGATGG - Intergenic
960296623 3:115952562-115952584 CAGGGGGAATGGTGAGAGGAGGG + Intronic
960437348 3:117644017-117644039 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
960736317 3:120784963-120784985 GAGGGTGGAAGGTGGGAGGAGGG - Intergenic
961287823 3:125820650-125820672 CTGGGGGAAAGGGGAGGGGATGG + Intergenic
961413136 3:126737713-126737735 CAGGTGGAGAGGAGGGAGGAAGG + Intronic
961678320 3:128582011-128582033 GAGGGGGAGGGGTGGGAGGAAGG - Intergenic
961899247 3:130195343-130195365 CTGGGGGAAAGGGGAGGGGATGG - Intergenic
962057825 3:131891565-131891587 GAGGGTGAAAGGTGGGAGGAGGG - Intronic
962121937 3:132570652-132570674 GAGGGTGGAAGGTGGGAGGAGGG - Intronic
962437871 3:135383149-135383171 CAGGGAGAATGCAGGGCGGAAGG + Intergenic
962892665 3:139686169-139686191 CAGGAGGAAAAGTGGGAAGAAGG - Intergenic
963393219 3:144696561-144696583 GAGGGTGGAAGGTGGGAGGATGG - Intergenic
963636721 3:147807181-147807203 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
963677198 3:148327292-148327314 CAGGGGGATTGGGGGGCGGGGGG - Intergenic
963851648 3:150215974-150215996 GAGGGGGAAAGGAGGGAGGATGG + Intergenic
964561428 3:158000786-158000808 GAGGGTGTAAGGTGGGAGGAGGG + Intergenic
964672695 3:159244442-159244464 CAGGGGAGAAGGTGGGCTCAGGG + Intronic
964694193 3:159488538-159488560 CAGAGGGAAAGGTCTGAGGAGGG + Intronic
964709911 3:159660929-159660951 CAGATGGACAGGTGGGTGGATGG - Intronic
964942665 3:162178301-162178323 CTGGGGGAAAGTAGGGTGGAGGG + Intergenic
965972233 3:174573674-174573696 CAGGGGGCAAGGTGAGGGGGAGG + Intronic
966172201 3:177094814-177094836 TAGGGGGAAAGGGTGGGGGATGG + Intronic
966242896 3:177774680-177774702 GAGGGGGAAAGGAGGAAGGAAGG - Intergenic
966263692 3:178011906-178011928 AAGGGTGAAGGGTGGGAGGAGGG - Intergenic
966398596 3:179525390-179525412 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
966457428 3:180133675-180133697 CAGTGAGAAAGGAGAGCGGAAGG - Intergenic
966935905 3:184709338-184709360 TCGGGGGCAGGGTGGGCGGATGG - Intergenic
967323001 3:188212645-188212667 AAGGGGGAAGGGTGGGGGCAGGG - Intronic
967451844 3:189633371-189633393 GAGGGTGGAAGGTGGGAGGAGGG - Intronic
967528659 3:190523512-190523534 GAGGGTGATAGGTGGGAGGAGGG - Intronic
967582273 3:191173110-191173132 CAGGGTGGAAGGTAGGAGGAGGG - Intergenic
967690147 3:192464283-192464305 CAAGGGGAAGGGTGGGAGGGGGG - Intronic
968016756 3:195341990-195342012 AAGGGGGGAAGGTGGGAGGGAGG + Intronic
968086940 3:195878038-195878060 CAGTGGGAAAGGGTGGTGGAGGG + Intronic
968107135 3:196009268-196009290 CAGGGGGCAGGGTGTGGGGAGGG - Intergenic
968208822 3:196829292-196829314 AAGGGGGAAAGGAGGGAAGAAGG - Exonic
968481114 4:833486-833508 GAGGGGGAAAGGAGGAAGGAGGG + Intergenic
968614621 4:1571745-1571767 CAGGGGGAAGGGAGCGTGGAAGG + Intergenic
968645980 4:1740708-1740730 CAGGAGGAGAGGTGGGCAGTGGG - Intronic
968682147 4:1928737-1928759 CAGGGGCAGAGGTGGGTGGGAGG + Intronic
968885543 4:3329181-3329203 CAGGGGGTCAGGTGGGTGGGAGG + Intronic
969150817 4:5167180-5167202 TTGGGGGCAAGGTGGGAGGATGG - Intronic
969383186 4:6821368-6821390 CAGGGGGAAAGGGTGGGAGACGG - Intronic
969593337 4:8134046-8134068 CATGGGCACAGGCGGGCGGATGG + Intronic
969618255 4:8265998-8266020 CAGGAGGAAGGCTGGGAGGAGGG - Intergenic
969680654 4:8641522-8641544 CTGGGAGAAAGGTGGGCGGCAGG + Intergenic
970039760 4:11782698-11782720 GAGGGAGAAAGGTGGGAGAAGGG + Intergenic
970123806 4:12787147-12787169 CAGAGGGTAAGGAGGGAGGATGG - Intergenic
970736570 4:19176994-19177016 CTAGGGGAAATGTGGGCAGAGGG - Intergenic
971218087 4:24680559-24680581 AAGGAGGAAAGGAGGGAGGAGGG + Intergenic
972199310 4:36694533-36694555 GAGGGTGGAAGGTGGGAGGAGGG + Intergenic
972220297 4:36947580-36947602 CAGGGGGAAAGGTAGAGAGAGGG - Intergenic
972230605 4:37068517-37068539 CAGGTGGAAATGTGGGGGAAAGG + Intergenic
972659740 4:41104627-41104649 CAGGGCCAAGGGTGGGAGGAGGG - Intronic
973563976 4:52165344-52165366 GAGGGGGGAGGGTGGGGGGAGGG - Intergenic
973750975 4:54021058-54021080 AAGGGGGAATGGAGGGTGGAAGG - Intronic
974021033 4:56692703-56692725 CAAGGGGAAAAGTGGGCGTTTGG - Intergenic
974454207 4:62105262-62105284 CAGGGTGAAGGGTGGGAGGAGGG - Intergenic
974881777 4:67767484-67767506 GAGGGTGAAAGGTGGGAGGAAGG - Intergenic
975093448 4:70429598-70429620 GAGGGTGAAGGGTGGGAGGAAGG + Intergenic
975151923 4:71032458-71032480 AAGGGGGAATGGAGGGCGGAAGG - Intergenic
975474097 4:74802528-74802550 GAGGGTGGAAGGTGGGAGGAGGG + Intergenic
975670465 4:76775102-76775124 CAGCGGGAAGGGTGGGAGGTGGG - Intronic
976097861 4:81528243-81528265 CAGGAGGAAAGCTGAGGGGATGG - Intronic
977058782 4:92229314-92229336 GAGGGGGGAAGGTGGGAGGGGGG + Intergenic
977062657 4:92275943-92275965 AAGGAGGAATGGAGGGCGGAAGG + Intergenic
977112226 4:92972748-92972770 GAGGGTGGAAGGTGGGAGGAGGG - Intronic
977278663 4:95011230-95011252 GAGGGTGGAGGGTGGGCGGAGGG - Intronic
977412303 4:96683569-96683591 GAGGGTGGAAGGTGGGAGGAGGG - Intergenic
977645385 4:99405894-99405916 CAGGGGAAAGGGTGGGAGAAGGG + Intergenic
978072716 4:104491870-104491892 AAGGGGGAAAGGTGGGGGGGAGG + Exonic
978199394 4:106007652-106007674 CAGAGGGAATGGTGGGAGGGAGG - Intergenic
978726030 4:111970543-111970565 CAGGGGAAAGGGTGGGAGGGGGG + Intergenic
978771727 4:112463868-112463890 GAGGGTGGAAGGTGGGAGGAGGG + Intergenic
978947632 4:114516960-114516982 AAGGGGGAAAGGTGGGGAAAAGG + Intergenic
979045672 4:115859578-115859600 GAGGGTGAAAGGTGGGAGGAGGG + Intergenic
979723534 4:123932699-123932721 CTGGGGGAAGGTTGGGGGGAGGG + Intergenic
980005114 4:127532798-127532820 GAGGGTGGAAGGTGGGAGGAAGG - Intergenic
980154296 4:129085855-129085877 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
980263512 4:130485107-130485129 CAGGGGGAAAGGGTGGGAGAGGG + Intergenic
980940339 4:139268120-139268142 AAGGGGGAAAGGAAGGGGGAAGG + Intronic
981099011 4:140810743-140810765 GAGAGGGAAAGGTGGGGAGAGGG - Intergenic
981099019 4:140810767-140810789 GAGAGGGAAAGGTGGGGAGAGGG - Intergenic
981482867 4:145256000-145256022 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
981672222 4:147300071-147300093 CAGGGAGACAGGAGTGCGGAAGG + Intergenic
981680792 4:147395416-147395438 CAGGGGAAAGGGTGGGAGGTGGG + Intergenic
981749668 4:148081870-148081892 CAGGGTGTAAGGTGGGCTGGTGG + Intronic
982086002 4:151836753-151836775 CAGGGTGGAGGGTGGGAGGAGGG - Intergenic
982410869 4:155075864-155075886 TAGGGGGAAGGGTGGGTGGGGGG - Intergenic
982602012 4:157463623-157463645 GAAGGTGAAAGGTGGGAGGAGGG + Intergenic
982683088 4:158456220-158456242 GAAGGGGGAAGGTGGGAGGAGGG + Intronic
983042309 4:162944146-162944168 GAGGAGGAAAGGTGGGGTGATGG + Intergenic
983833358 4:172359353-172359375 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
984228371 4:177063565-177063587 CATGGGGAAGGGTGTGAGGAGGG + Intergenic
984228397 4:177063719-177063741 CAGGGGGAAGGGTGTGAGGAGGG + Intergenic
984321775 4:178206689-178206711 AAGGGGGAAGGGTGGGAGAAGGG + Intergenic
984452916 4:179926642-179926664 GAGGGTGAAAGGTGGAAGGAGGG - Intergenic
984760092 4:183356419-183356441 CAGGGAGAAAGGAGGGAGGGAGG - Intergenic
984815369 4:183831128-183831150 GAGGGGGGATGGTGGGGGGATGG + Intergenic
984857325 4:184206150-184206172 CCTGGGGGAAGGAGGGCGGAGGG + Intronic
985034368 4:185823171-185823193 AAGGGGAAAAGGAGGCCGGAGGG - Intronic
985324145 4:188748704-188748726 GAGGGGGGAAGGTGGGAGGAGGG - Intergenic
985469117 5:26880-26902 GAGGGGGGAGGGTGGGAGGAGGG - Intergenic
985522960 5:387557-387579 CAGGGTGAAAGGCAGGTGGAGGG - Intronic
985586452 5:740122-740144 CAGGGGGAGTGGTGGGAGGAGGG + Intronic
985601040 5:832299-832321 CAGGGGGAGTGGTGGGAGGAGGG + Intronic
985639019 5:1054496-1054518 CTGGGGAAACGCTGGGCGGAGGG + Intronic
985838203 5:2285974-2285996 CATGGGGGAAGCTGGGTGGAAGG - Intergenic
986167091 5:5283462-5283484 CTGGGGGGGAGGTGGGGGGAGGG - Intronic
986264075 5:6177582-6177604 GAGGGTGGAAGGTGGGAGGAGGG + Intergenic
986500779 5:8397090-8397112 CAGGGAGAAAGGTAGGCCCAGGG - Intergenic
986621215 5:9677255-9677277 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
987092252 5:14518634-14518656 GAGGGAGAAGGGTGGGAGGAGGG - Intronic
987130807 5:14858256-14858278 CTGGGGGAAGGGTGGGAGGCGGG - Intronic
987333627 5:16878826-16878848 CAGGGAGAAGGGTGGGAGGGTGG + Intronic
987336941 5:16905414-16905436 CAGGGGGACAGCTGGAGGGAAGG + Intronic
987446881 5:18031191-18031213 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
987550947 5:19380648-19380670 TAGGGTGAAGGGTGGGAGGAGGG + Intergenic
987784129 5:22477236-22477258 GAGGGTGAAAGGTGAGAGGAGGG - Intronic
987891152 5:23880428-23880450 AAGGGGGAAAGGTAGGAGGGAGG + Intergenic
988147304 5:27327008-27327030 GAGGGTGGAAGGTGGGAGGAGGG + Intergenic
988232057 5:28492026-28492048 CAGGGCAAAAGGTAGGAGGAGGG + Intergenic
988424676 5:31049743-31049765 TAGTAGGAAAGGTGGGAGGAAGG - Intergenic
989077197 5:37576121-37576143 GAGGGGGGAAGGAGGGCGGAGGG - Intronic
989351660 5:40493802-40493824 CGGGGGAAAGGGTGGGAGGAGGG - Intergenic
989478052 5:41896833-41896855 TAGAGTGAAAGGTGGGAGGAGGG + Intergenic
989509544 5:42268957-42268979 GAGGGTGAAGGGTGGGAGGAAGG + Intergenic
990046373 5:51437322-51437344 AAGGGCAAATGGTGGGCGGAGGG - Intergenic
990500838 5:56395628-56395650 GAGAGGGAAAGGTGGGAGGAGGG + Intergenic
991693157 5:69245270-69245292 GAGGGGAAAAGGAGGGAGGACGG - Intronic
991974726 5:72174915-72174937 AAGGGGGAAAGGGGGAAGGAGGG - Intronic
992032352 5:72734437-72734459 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
992605157 5:78448066-78448088 GAGGGGGAAAGGAGGAGGGAGGG - Intronic
993540046 5:89138124-89138146 AAGGGGGAAGGATGGGAGGAGGG - Intergenic
993608496 5:90024959-90024981 CAGGGGGAAAGATGGGATGGGGG + Intergenic
993719783 5:91310986-91311008 AAGGAAGAAAGGAGGGCGGAAGG - Intergenic
993743766 5:91570516-91570538 CAGGGGAAAGGGTGGGAGGGGGG + Intergenic
994049589 5:95347323-95347345 CAGGGGGAAAGGAGGCCAGGTGG + Intergenic
994074872 5:95639447-95639469 CTGGGGGACGGGTGGGCAGAAGG + Intergenic
994423159 5:99547804-99547826 GAGGGTGAAAGGTGAGAGGAGGG + Intergenic
994559828 5:101353541-101353563 AAAGGGGGAAGGTGGGGGGAGGG + Intergenic
994606614 5:101975447-101975469 CAGGGGGAAAGATGGGAGTGGGG - Intergenic
994777670 5:104055506-104055528 CAGGGAGAAGGGTGGGAGGGAGG - Intergenic
994957527 5:106552554-106552576 CAGGGTGGAAGGTGGGAGGAGGG + Intergenic
995034557 5:107518490-107518512 CTGGGGGACTGGTGGGCAGAAGG + Intronic
995769231 5:115651758-115651780 ATGGGGGAATGGAGGGCGGAAGG - Intergenic
996017468 5:118556662-118556684 GAGGGCAAAAGGAGGGCGGAAGG - Intergenic
996109052 5:119543255-119543277 CAGGGGTGAAGGTGGGAGGAGGG - Intronic
996346416 5:122493145-122493167 CAGGGGTAAAGGAGGACTGAAGG + Intergenic
996376115 5:122809432-122809454 AAGGGGGACAGATGGGAGGATGG + Intronic
996784351 5:127222562-127222584 GAGGGAGAAGGGTGGGAGGAAGG + Intergenic
997038408 5:130221538-130221560 GAGGGTGGAAGGTGGGAGGAGGG - Intergenic
997124235 5:131209783-131209805 CAGGGGGACAGGTGGGTGAGAGG + Intergenic
997438525 5:133892374-133892396 CAGGGGCAGGGGTGGGTGGATGG - Intergenic
997579693 5:135009509-135009531 CAGGTGGACAGATGGGTGGATGG + Intronic
997860800 5:137413943-137413965 CAGGAGAACAGGTGGGTGGAGGG - Intronic
998037259 5:138927466-138927488 GAGGGGGAAGGGGGGGCGGGTGG - Intronic
999054060 5:148554790-148554812 GAGGGTGGAAGGTGGGAGGAGGG - Intronic
999295882 5:150459118-150459140 GAGGGTGGAGGGTGGGCGGAAGG + Intergenic
999338033 5:150740894-150740916 CAGGGGGAAAGCTGGGAAGGGGG + Intronic
999362755 5:150999623-150999645 CAGGGGAACAGGTGAGCAGATGG - Intergenic
1000071712 5:157745917-157745939 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1000414096 5:160965345-160965367 CAGGAGGAAAGGGGGGCGGGGGG - Intergenic
1000589440 5:163140930-163140952 GAGGGCGGAAGGTGGGAGGAGGG + Intergenic
1000687131 5:164264837-164264859 TGGGGGGAAAGGTGGGGGAAGGG + Intergenic
1000734257 5:164879401-164879423 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1001085783 5:168699222-168699244 CAGGTGGACACGTGGGCGGGCGG + Intronic
1001161998 5:169327577-169327599 CAGGGGGAAGGGTGGGAGGAGGG + Intergenic
1001331603 5:170766464-170766486 AAGGGGGAATGGAGGGTGGAAGG + Intronic
1001334833 5:170788543-170788565 CAGGGGGCAAGGTAAGTGGAAGG - Intronic
1001456191 5:171862121-171862143 CAGGGGGAAGGGAGGGGGCAGGG - Exonic
1001849038 5:174947103-174947125 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1002001751 5:176199998-176200020 CATGGCCAAAGGTGGGAGGAGGG + Intergenic
1002102327 5:176863719-176863741 GAGGGGGAAAAGGGGGAGGAGGG - Intronic
1002214497 5:177620359-177620381 CAGGGGGAAGGGTGGGAAGTGGG + Intergenic
1002252583 5:177938972-177938994 CATGGCCAAAGGTGGGAGGAGGG - Intergenic
1002298143 5:178242480-178242502 CAGGGGGGAAAGTGGGCGTGTGG - Intronic
1002368973 5:178734705-178734727 GAGGGAGAAGGGTGGGAGGAGGG - Intergenic
1002441577 5:179267123-179267145 CTGGGGGAAGAGTGGGCGGCGGG - Intronic
1002570426 5:180136673-180136695 CACGGGGAGAGGAGGGGGGACGG + Intronic
1003074072 6:2968305-2968327 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1003863592 6:10343786-10343808 CAGGGGAACAGGTAGGGGGAAGG - Intergenic
1003864075 6:10347739-10347761 CAAGGGGAGAGGTTGGTGGAAGG + Intergenic
1004160807 6:13211265-13211287 CAGGGGGAGGGGTGGGAGGCTGG - Intronic
1004335585 6:14761660-14761682 GAGGGGGGAAGGTGGGAGGAGGG + Intergenic
1004441374 6:15658451-15658473 CAGGGGTGCAGGTGGGCGGCAGG + Intronic
1005008194 6:21311235-21311257 CAGGAGGCAAGGCGGGAGGATGG - Intergenic
1005014806 6:21365943-21365965 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1005105847 6:22223465-22223487 CAGGAGGAGAGGTGGGAAGAAGG - Intergenic
1005184060 6:23143519-23143541 GAGGGTGAAGGGTGGGGGGAAGG + Intergenic
1005189988 6:23210448-23210470 CAGGGGGAAAGGTAGGTGGGAGG - Intergenic
1005296039 6:24428378-24428400 GAGGGCGGAAGGTGGGAGGAGGG - Exonic
1005792700 6:29322408-29322430 CAGGGGAAAGGGTGGGAGCAGGG - Intergenic
1005894385 6:30165048-30165070 CAGAGAGAGAGGTGGGAGGAAGG - Intronic
1005957914 6:30677336-30677358 GGGGGGGAAGGGTGGGCAGAAGG - Intronic
1006095685 6:31655178-31655200 GAGAGGCCAAGGTGGGCGGATGG - Intronic
1006271215 6:32968802-32968824 CTGGGGGAAAGGCGGGGGGTGGG + Intronic
1006449783 6:34099276-34099298 CAGGGGTACAGGTGGTCAGATGG + Intronic
1007116956 6:39349557-39349579 CAGGGGGAGCAGTGGGTGGAAGG + Intronic
1007209860 6:40184520-40184542 CAGGGGGAAAGGAGTGGGAAAGG + Intergenic
1007736789 6:43987023-43987045 GAGGGGGAGAGGTGGCAGGATGG - Intergenic
1007745159 6:44039144-44039166 AATGGGGAAAGGTGTGCGGAGGG + Intergenic
1008004274 6:46393478-46393500 CAGGGGAAACGGTGGGATGAGGG + Intronic
1008111838 6:47503372-47503394 CAGGAGGAAGGGTGGCTGGAAGG + Exonic
1008250739 6:49236849-49236871 CAGGGGGAAAGGTGGGAGCTGGG - Intergenic
1008263594 6:49396698-49396720 TAGGAGGAAGGGTGGGAGGATGG + Intergenic
1008483087 6:52006837-52006859 CAGGGGAAAGGGTGGGAGGTGGG - Intronic
1008531180 6:52461212-52461234 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1008642466 6:53478664-53478686 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1009319564 6:62270330-62270352 GAGAGAGAAAGGTGGGCGGGGGG - Intronic
1009417639 6:63433155-63433177 AAGGGGGAAAGTTGGGGGGGTGG + Intergenic
1009464193 6:63951142-63951164 AAGGAGGAATGGTGGGTGGAAGG - Intronic
1009484740 6:64206965-64206987 CGGGGTGGAAGGTGGGAGGAAGG - Intronic
1009945597 6:70338768-70338790 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1011001015 6:82588711-82588733 CAGAGGCTAAGGTGGGAGGATGG + Intergenic
1011257026 6:85432991-85433013 GAGGGTGGAAGGTGGGAGGAGGG - Intergenic
1011289590 6:85762858-85762880 CAGGGGAAAGGGTGGGAGGTTGG - Intergenic
1011314531 6:86016798-86016820 CAGGGAGGAAGGGGGGCGGTGGG + Intergenic
1011565995 6:88672549-88672571 CAGGGGGAAGTGTGGGATGAGGG + Intronic
1011628156 6:89299990-89300012 CAGGGGAGAAGGAGGGCTGAAGG + Intronic
1012166169 6:95955215-95955237 GAGGGTGGAAGGTGGGAGGAGGG + Intergenic
1012322476 6:97867523-97867545 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1012325227 6:97908316-97908338 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1012540134 6:100353071-100353093 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1012591454 6:100986004-100986026 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1012693461 6:102347757-102347779 GAGGGTGGAAGGTGGGAGGAGGG + Intergenic
1012727324 6:102831016-102831038 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1012968138 6:105697592-105697614 TAGGGGGAGGGGTGGGCAGAGGG + Intergenic
1013272886 6:108559721-108559743 CAGGGGGAGGGCTGGGCGGCGGG - Intergenic
1013309347 6:108879172-108879194 TAGGTGGATAGGTGGGTGGATGG - Intronic
1013663698 6:112325393-112325415 CAAGAGGAAAGGGAGGCGGAGGG + Intergenic
1013913404 6:115306035-115306057 CAGGGGAAAGGGTGGGAGGGAGG - Intergenic
1013954317 6:115822897-115822919 CAGGGGAAAGGGTGGGAAGAGGG - Intergenic
1014140640 6:117938516-117938538 CAGGGGGGCAGGTGGGCTGGGGG - Intronic
1014179578 6:118370408-118370430 GAGGGGGGAAGGTGAGAGGAGGG + Intergenic
1014402396 6:121006656-121006678 GAGGGTGGAAGGTGGGAGGAGGG + Intergenic
1014913291 6:127118569-127118591 GAGGGGGAGAGGAGGGGGGATGG - Intergenic
1014934277 6:127368193-127368215 AAGGGGGAAAGGGGAGAGGATGG - Intergenic
1015395154 6:132725603-132725625 GAGGGGGGATGGTGGGAGGAGGG - Intronic
1015547143 6:134372799-134372821 CAGGGTAAAAAGTGGGCTGATGG + Intergenic
1015636271 6:135277812-135277834 GAAGGGGGAAGGTGGGAGGAGGG + Intergenic
1015821954 6:137270917-137270939 GAGGGGGGAAGGTGGGAGGAGGG + Intergenic
1016753976 6:147663318-147663340 GAGGGGGAAAGGTGGGAGGAGGG + Intronic
1017056290 6:150438992-150439014 CAGGGAGAAGGGTGGGAGGTGGG + Intergenic
1017261146 6:152389346-152389368 GAGGGTGGAAGGTGGGAGGAGGG - Intronic
1017400984 6:154061667-154061689 GAGGGTGGAAGGTGGGAGGAGGG + Intronic
1017717413 6:157222459-157222481 CAGCGGGAGAGGTGGACGGCAGG - Intergenic
1017929302 6:158938494-158938516 CAGGTGAAAAGGAGGGAGGAAGG + Intergenic
1018027264 6:159816173-159816195 CAGGGGGAGAGGTGGGGGGGAGG - Intronic
1018273155 6:162102182-162102204 CTGGGGGATGGGTGGGGGGACGG - Intronic
1018393948 6:163362628-163362650 CAGGGGGAGAAGTGGCCGGGAGG + Intergenic
1018654671 6:166024161-166024183 TAGGGGGAGAGGGAGGCGGATGG + Intergenic
1018864290 6:167735200-167735222 CAGCGGCAGAGGTCGGCGGAAGG - Intergenic
1018869531 6:167770488-167770510 CAAGGAGAAAGGAGGGGGGAAGG - Intergenic
1019078848 6:169413596-169413618 CAGAGGCCAAGGTGGGAGGATGG + Intergenic
1019142899 6:169959503-169959525 CAGGGGGAGAGGAGGGAGGAGGG - Intergenic
1019343884 7:520455-520477 CAAGTGGAAATGTGGGTGGAGGG - Intergenic
1019488165 7:1298945-1298967 CAGGGGGAGAGGGGGGCTGTGGG + Intergenic
1019575621 7:1736288-1736310 CAGGGGGAAAGGTGGGCGGAGGG - Intronic
1019660159 7:2219660-2219682 AAGGGGGCAAGGGGGGCAGAGGG + Intronic
1019712040 7:2522193-2522215 CTGGGGGAAGGGAGGGAGGAGGG + Intronic
1020404635 7:7818131-7818153 GAGGGTGGAAGGTGGGAGGAGGG - Intronic
1020541274 7:9462967-9462989 AAGGAGGAATGGAGGGCGGAAGG + Intergenic
1021106668 7:16646057-16646079 CCGGGGGAATGGTGGGGGTACGG - Intergenic
1021204294 7:17760895-17760917 AAGGGAGGAAGGTGGGAGGAGGG + Intergenic
1021824369 7:24533405-24533427 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1021839803 7:24713365-24713387 CAGGGAGAAGGGTGAGGGGAAGG + Intronic
1022021611 7:26404949-26404971 CAGGGAGAAAGGAGAGCAGAAGG + Intergenic
1022037161 7:26545387-26545409 TAGAGGGAAAAGTGGGCAGATGG + Intergenic
1022046025 7:26623230-26623252 CATGGGGAGAGGTGTGTGGATGG - Intergenic
1022447258 7:30480499-30480521 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1022509072 7:30923662-30923684 CAGGGGCAGGGGCGGGCGGAGGG + Exonic
1022754584 7:33272198-33272220 GAGGTTGAAAGGTGGGAGGAGGG + Intronic
1023128398 7:36977711-36977733 TAGAGGGGAAGGAGGGCGGAAGG + Intronic
1023699373 7:42877616-42877638 GAGGGGGACTGGTGGGCAGAGGG - Intergenic
1023819613 7:43973244-43973266 CAGCGTGGAAGGTGGGCGGCAGG + Intergenic
1024152426 7:46585982-46586004 TAGGGTGGAAGGTGGGAGGAGGG + Intergenic
1024627533 7:51220781-51220803 GAGGGCGGAAGGTGGGAGGAGGG - Intronic
1024638197 7:51308050-51308072 CAGATGGATAGGTGGGCGGACGG + Intronic
1024665080 7:51538089-51538111 CAGGGGGAAGGGTGGGAGGGAGG - Intergenic
1024851981 7:53729568-53729590 CAGGGCAAATGGTGGGAGGAGGG - Intergenic
1025951057 7:66145850-66145872 CAGGGTGAAGGGTGGGCGTGGGG - Intronic
1026113589 7:67477813-67477835 GAGGGTGGAAGGTGGGAGGAGGG - Intergenic
1027189570 7:75989061-75989083 CCGGGGGAAGGCTGGGTGGAGGG + Intronic
1027243219 7:76347021-76347043 GAGGGGGAGAGGTTGGAGGAAGG - Intronic
1027354263 7:77340924-77340946 AAGGGGGAATGGAGGGTGGAAGG - Intronic
1027678158 7:81184825-81184847 GAGGGTGGAAGGTGGGAGGAGGG + Intronic
1028420424 7:90626698-90626720 CAGAGGCTAAGGTGGGAGGATGG + Intronic
1028581409 7:92413333-92413355 CAGGGAGAAAGGGGGGAGAAGGG - Intergenic
1028596824 7:92554748-92554770 CTGTGGGAAGGGTGGGAGGAGGG - Intergenic
1028703345 7:93809244-93809266 TAGGGGGAAGGGTGGGAGGGGGG + Intronic
1029054423 7:97726353-97726375 GAGGGGGGAGGGTGGGAGGAGGG - Intergenic
1029069190 7:97881422-97881444 CTGGGGGAAAGGGGAGGGGATGG - Intergenic
1029080959 7:97973523-97973545 CAGGCGGAGAGGGGGGCGGGGGG - Intergenic
1029744664 7:102510213-102510235 CAGCGTGGAAGGTGGGCGGCAGG + Exonic
1029762655 7:102609375-102609397 CAGCGTGGAAGGTGGGCGGCAGG + Exonic
1029905120 7:104084577-104084599 CAGGGGGAAGGATGGGAGGAGGG + Intergenic
1029955650 7:104636522-104636544 GAGGGAGAAGGGTGGGAGGAAGG - Intronic
1030280492 7:107769576-107769598 GAGGGTGAAGGGTGGGAGGAAGG + Intronic
1030349373 7:108466676-108466698 GATGGGGAAGGGTGGGAGGAGGG + Intergenic
1030416681 7:109252763-109252785 CAGTGGGGAGGGTGGGAGGAAGG + Intergenic
1030732443 7:113006022-113006044 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1031330298 7:120455810-120455832 CAGGGTTAAGGGTGGGAGGAAGG + Intronic
1031464941 7:122097514-122097536 AAGGGTAAAAGGTGGGAGGAGGG - Intronic
1031869330 7:127075164-127075186 CAGGGGTAAAGGTGGGAGATGGG + Intronic
1031878651 7:127170836-127170858 CAGGGGAAAGGGTGGGAGAAGGG + Intronic
1032189604 7:129756637-129756659 CATGGGGAGAGCTGGGAGGAGGG - Exonic
1032685063 7:134224543-134224565 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1032775046 7:135104058-135104080 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1032778279 7:135138735-135138757 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1032911800 7:136440855-136440877 CAGGGGAAATGGTGGGAGAAGGG - Intergenic
1033036424 7:137879962-137879984 CAGGGGGCAGAGTGGGCGGAGGG + Exonic
1033225621 7:139559938-139559960 TAGGGGAAAAGGTGGGTGGAGGG + Intergenic
1033310137 7:140255342-140255364 GAGGGGCCGAGGTGGGCGGATGG - Intergenic
1033462510 7:141560610-141560632 CAGGGGGAAAGGTGGGAGTGGGG - Intronic
1033600286 7:142884217-142884239 TTGGGGGAGAGGTGGGCGGCTGG + Intronic
1033807111 7:144966977-144966999 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1033905483 7:146196542-146196564 CAGAGGGAAAGGAGGGAGGGAGG + Intronic
1034059347 7:148072142-148072164 CAGGGGTAAAGGTAGGAGGGAGG - Intronic
1034697237 7:153064660-153064682 CAGATGGACAGGTGGGTGGATGG - Intergenic
1035251392 7:157599849-157599871 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251397 7:157599865-157599887 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251402 7:157599881-157599903 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251412 7:157599911-157599933 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251417 7:157599927-157599949 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251430 7:157599975-157599997 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251435 7:157599991-157600013 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251440 7:157600007-157600029 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251445 7:157600023-157600045 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251450 7:157600039-157600061 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251468 7:157600101-157600123 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251473 7:157600117-157600139 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251486 7:157600165-157600187 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251491 7:157600181-157600203 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251496 7:157600197-157600219 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035251501 7:157600213-157600235 CAGGTGGAGAGGTGGGCAGGTGG - Intronic
1035326276 7:158068030-158068052 TATGGGGAAAGGAGGGAGGAAGG + Intronic
1035361795 7:158318254-158318276 GAGTGGGAAAGGGGGGAGGAGGG + Intronic
1035367440 7:158358210-158358232 CCGGAAGAAAGGTGGGCGTAGGG - Intronic
1035413794 7:158667396-158667418 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413804 7:158667425-158667447 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413814 7:158667454-158667476 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413824 7:158667483-158667505 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413892 7:158667683-158667705 TAGTGGGTAAGGCGGGCGGAGGG - Intronic
1035413934 7:158667800-158667822 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413955 7:158667859-158667881 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035413965 7:158667888-158667910 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414003 7:158668002-158668024 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414024 7:158668061-158668083 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414034 7:158668090-158668112 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035414124 7:158668350-158668372 TAGTGGGTAAGGAGGGCGGAGGG - Intronic
1035650070 8:1257405-1257427 CAGGCAGAGAGGTGAGCGGAGGG - Intergenic
1035726199 8:1825387-1825409 CAGGGGGACAGGTGGGGTGCAGG - Intronic
1035938823 8:3873552-3873574 CAGGGTGGACGGTGGGAGGAGGG + Intronic
1036251446 8:7166193-7166215 CTGGGGGAAAGGGGAGGGGATGG - Intergenic
1036366042 8:8121267-8121289 CTGGGGGAAAGGGGAGGGGATGG + Intergenic
1036472491 8:9063909-9063931 AAGGGGGAATGGAGGGTGGAAGG + Intronic
1036615051 8:10381443-10381465 CAGGGGAAGAGCTGGGAGGAAGG + Intronic
1036663048 8:10720858-10720880 GAGGGGGGAAGGAGGGAGGAAGG - Intergenic
1036884895 8:12544813-12544835 CTGGGGGAAAGGGGAGGGGATGG - Intergenic
1037191425 8:16130624-16130646 GAGGGTGGAAGGTGGGAGGAGGG - Intronic
1037617740 8:20534666-20534688 GAGGGTGAAAGGTGGGAGGAGGG - Intergenic
1038064068 8:23943665-23943687 AAGAGGGGAAGGTGGGAGGAAGG - Intergenic
1038519119 8:28214418-28214440 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1038545958 8:28425872-28425894 CAGGGGGTGAGGCGGGAGGATGG - Intronic
1038684586 8:29704724-29704746 CAGGGAGAAAAGTGGGAGGGGGG - Intergenic
1039090972 8:33829320-33829342 AAGGGGATAAGGTGGGAGGAGGG - Intergenic
1039572502 8:38599058-38599080 CAGGGGAAAGGGTGGGAGGGGGG - Intergenic
1039638299 8:39190907-39190929 GAGGGTGGAAGGTGGGAGGAGGG - Intronic
1039747990 8:40449210-40449232 CAGGGGAAAGGGTGGGAAGAGGG - Intergenic
1039846576 8:41329901-41329923 CAAGGGGAAAGGTGGGAAGGTGG - Intergenic
1039990670 8:42485058-42485080 AAGGAGGAAAGGTGGGCTGGAGG - Intronic
1040539550 8:48340040-48340062 GAGGGTGACAGGTGGGAGGAGGG - Intergenic
1040883576 8:52234959-52234981 CAGGGGAAAGGGTGGGAAGAGGG + Intronic
1040926851 8:52693778-52693800 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1041197015 8:55410631-55410653 CAGGGGCAAATGGGGACGGATGG - Intronic
1041304866 8:56447843-56447865 CAGATGGAAAGGTGGACGGACGG - Intergenic
1041306659 8:56468847-56468869 GAGGGGGGAAGGTGTGAGGAGGG + Intergenic
1041924377 8:63221543-63221565 GAGGGGGAAAGGGGAGGGGAGGG - Intergenic
1042095118 8:65206976-65206998 CAGGGGGAAGGGTGGGAAGGGGG - Intergenic
1042161054 8:65895965-65895987 CAGGGGAAATGGTGGGAGGGTGG + Intergenic
1042591876 8:70404043-70404065 AAGGGGCAAAGGTGGACGCAGGG + Intergenic
1043397121 8:79849223-79849245 GAGGGTGGAAGGTGGGAGGAGGG + Intergenic
1043489697 8:80736690-80736712 CAGGGGAAATAGTGGGAGGAGGG + Intronic
1044001153 8:86883020-86883042 GAGGGTGGAAGGTGGGAGGAAGG + Intronic
1044058730 8:87605714-87605736 CAGGGGGAAGGTGGGGGGGAGGG + Intronic
1044462240 8:92458827-92458849 GAGGGTAAAAGGTGGGTGGATGG + Intergenic
1045171042 8:99668662-99668684 AAGGGGAAAAGGTGGGGGGTTGG - Intronic
1045239442 8:100386251-100386273 GAGGGTGGAAGGTGGGAGGAGGG + Intronic
1045967028 8:108036679-108036701 CTGGGGGTGAGGTGGGAGGAAGG + Intronic
1046159769 8:110345650-110345672 TAGGGTGGAAGGTGGGAGGAGGG + Intergenic
1046682231 8:117183103-117183125 CAGGTGGAGAGGTGGGAGGCTGG + Intergenic
1046736470 8:117781469-117781491 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1047008235 8:120643417-120643439 CAGGAGGAAGGGTGGGAGGGTGG - Intronic
1048896590 8:138997811-138997833 TATGGGGAGAGGTGGGCTGAGGG - Intergenic
1049169214 8:141148234-141148256 CTGGTGGAAAGGAGGGAGGAGGG + Intronic
1049447812 8:142639435-142639457 CAGGGGGATAGGTGGATGGACGG + Intergenic
1049448185 8:142641250-142641272 CTTGGGGAAAGGTGGGCAGGTGG + Intergenic
1049756178 8:144312191-144312213 CAGGGGTGGAGGTGGGCGGGGGG - Exonic
1049854897 8:144855255-144855277 CAGGGGGAGAGGAGGGCAGTAGG + Intergenic
1051733678 9:20175229-20175251 CAGGGGGAAAGGTGGGAAGGCGG + Intergenic
1051853425 9:21535605-21535627 GAGGGAGAAAGGAGGGTGGAGGG + Intergenic
1052081376 9:24210011-24210033 CAGGGGGAAGTGTGGGAGGCAGG + Intergenic
1052213550 9:25936965-25936987 GAGGGGGAAATGTGGGGGGATGG - Intergenic
1052970407 9:34373800-34373822 GAGGGGGAGAGGAGGGAGGAAGG + Intronic
1052973915 9:34398395-34398417 CAAGGGGAAGGGTGGCAGGAGGG + Exonic
1053060119 9:35024099-35024121 AAGGGGGAATGGAGGGCGGAAGG + Intergenic
1053128750 9:35604027-35604049 GCGGCGGAACGGTGGGCGGAGGG - Intergenic
1053262776 9:36684746-36684768 CAGGGGGCAGGGTGGGAGGTAGG - Intergenic
1053365086 9:37517206-37517228 CAGGGGGAAGGGTGGGAGCAGGG + Intronic
1053801496 9:41766943-41766965 CAGGAGGAGAGGTGTGCAGAGGG - Intergenic
1054189927 9:61979097-61979119 CAGGAGGAGAGGTGTGCAGAGGG - Intergenic
1055026077 9:71723032-71723054 CAGGGGAGGAGGTGGGAGGAAGG + Intronic
1055062045 9:72079046-72079068 CAGTGGGAAGGGTGGGAGGGAGG + Intergenic
1055340086 9:75272392-75272414 GAAGGGGGAAGGTGGGAGGAGGG - Intergenic
1055611544 9:78030730-78030752 GGGGTGGAAAGGTGGGCAGAGGG - Intronic
1056027148 9:82510764-82510786 CAGGGGGAAGGGTGGGAGGGAGG + Intergenic
1056150192 9:83778543-83778565 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1056391725 9:86147034-86147056 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1056592080 9:87971962-87971984 GAGAGGCCAAGGTGGGCGGATGG + Intronic
1056850894 9:90082640-90082662 CAGGGTGACAGGTGGGCAGGTGG + Intergenic
1057305208 9:93908348-93908370 CAGGGGGGTAGGTGGGTGGGTGG + Intergenic
1057550359 9:96047627-96047649 CAGGGGGAAGGGTGAGGGCAGGG - Intergenic
1057913263 9:99036310-99036332 CAGGGAGAAAGGGGGATGGATGG + Exonic
1057959760 9:99443292-99443314 GAAGGTGAAAGGTGGGAGGAGGG + Intergenic
1058108058 9:100997456-100997478 AAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1058316541 9:103573982-103574004 CAGGGTGGAAGATGGGAGGAGGG + Intergenic
1059263230 9:112999721-112999743 CACAGGGCAAGGTGGGCAGAAGG + Intergenic
1059363428 9:113766276-113766298 AAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1059896416 9:118871127-118871149 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1060296144 9:122344202-122344224 GAGGGTGGAAGGTGGGAGGAGGG + Intergenic
1060667002 9:125437918-125437940 CAGGGAGAGGGGTGAGCGGAGGG - Exonic
1060831758 9:126722089-126722111 CAGGAGGAAGGGTGAGCAGAGGG - Intergenic
1060843940 9:126819573-126819595 GAGGGGGAAAGATGGGGGAATGG - Intronic
1061261382 9:129482669-129482691 GAGGGGGAGAGGCGGGCGGCGGG + Intergenic
1061537380 9:131258469-131258491 CAGGGGGCAAGGTGGGCTGGGGG + Exonic
1061905542 9:133694807-133694829 CAGATGGGAAGGTGGGCAGATGG + Intronic
1062050564 9:134444552-134444574 GAGGGGGAAAGGAGGGAGGGAGG - Intergenic
1062061312 9:134496814-134496836 CTGGGGGAGAGGTGTGCAGATGG - Intergenic
1062145997 9:134989964-134989986 CTGGGGGAGAGGTGGGTGAAAGG + Intergenic
1062250026 9:135589237-135589259 CAGGTGGACAGTGGGGCGGACGG - Intergenic
1062318847 9:135980801-135980823 TAGGGGTAGAGGTGGGAGGAGGG - Intergenic
1062522053 9:136961971-136961993 CAGGGGGACAGGTGGGCTGAGGG + Intergenic
1203471438 Un_GL000220v1:116801-116823 AGGGGGGAACGGGGGGCGGACGG - Intergenic
1203479259 Un_GL000220v1:160773-160795 AGGGGGGAACGGGGGGCGGACGG - Intergenic
1203624602 Un_KI270750v1:1394-1416 AAGAGGGAGAGGTGGGTGGAGGG + Intergenic
1185887280 X:3794047-3794069 CAGGGGGAAGGGTGGGAGGGGGG - Intergenic
1185930552 X:4198386-4198408 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1185932314 X:4216891-4216913 GAGAGGCCAAGGTGGGCGGATGG + Intergenic
1186047297 X:5550380-5550402 CAGAGGGAAAGGGAGGCGGAGGG - Intergenic
1186228009 X:7422205-7422227 CAGGGGGTAGGGTGGAGGGAGGG - Intergenic
1186330258 X:8525018-8525040 GAGGGTGGAAGGTGGGAGGAGGG - Intergenic
1186456560 X:9714434-9714456 CAGGGAGGAAGGTAGGGGGAAGG + Intronic
1186472556 X:9832736-9832758 CAGGGGTAAGGGTGGGGGGCGGG + Intronic
1186505696 X:10090153-10090175 TTGGAGGAAAGGTGGGAGGAAGG + Intronic
1186572840 X:10734387-10734409 GAGGGGGAAGGGTGGGAAGAGGG + Intronic
1186749245 X:12604806-12604828 GAGGGTGAAGGGTGGGAGGAGGG - Intronic
1187236614 X:17474068-17474090 GAGGGTGGAAGGTGGGAGGAGGG - Intronic
1187306543 X:18100214-18100236 GAGGGTGGAAGGTGGGAGGAGGG + Intergenic
1187464735 X:19516748-19516770 GAGGGTGAAGGGTGGGAGGAAGG - Intergenic
1187636544 X:21235474-21235496 GAGGGGGTAGGGTGGGAGGATGG + Intergenic
1187653672 X:21442997-21443019 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1187661719 X:21554474-21554496 GAGGGTGGAAGGTGGGAGGAGGG - Intronic
1187704295 X:21993978-21994000 AAGGGGGAAAGGAGGGAGGGAGG - Intronic
1187890230 X:23927738-23927760 GAGGGTGGAAGGTGGGAGGAGGG - Intronic
1188134449 X:26477324-26477346 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1188430873 X:30104600-30104622 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1188890040 X:35599011-35599033 CAGGGGAAAAGGTGGAGGGGTGG + Intergenic
1188910688 X:35843447-35843469 GAGGGAGACAGGTGGGAGGAGGG - Intergenic
1188942634 X:36259855-36259877 GAGGGGGAAAAGTGGGAGAAGGG - Intronic
1189157533 X:38773844-38773866 GAGGGGGAAAGCAGGGTGGAGGG + Intergenic
1189584165 X:42440701-42440723 GAGGGTGGAAGGTGGGAGGAGGG + Intergenic
1189890118 X:45592132-45592154 CAGGGGGATGGGTGGGGGGTGGG - Intergenic
1190685751 X:52871273-52871295 CAGGGGAAAGGGTGGGAGGGGGG + Intergenic
1190732349 X:53234311-53234333 CATGGGGGGAGGTGGGTGGAAGG + Exonic
1191137505 X:57082079-57082101 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1191180192 X:57553936-57553958 GAGGGGGAAGGGTGTGAGGAGGG + Intergenic
1191661933 X:63660391-63660413 GAGGGTGGAAGGTGGGAGGAGGG + Intronic
1191805962 X:65134117-65134139 AAGGGGGAATGGAGGGTGGAAGG + Intergenic
1191918609 X:66229446-66229468 CAGGGGAAAGGGTGGGAGGGAGG + Intronic
1192113089 X:68384902-68384924 CCGGGGGAAGGTTGGGAGGAGGG + Intronic
1192183153 X:68928929-68928951 CAGGAGGAAAGGAGGGAGGAAGG + Intergenic
1192186242 X:68948550-68948572 CAGGGGGAAAGCTGGCCTCATGG + Intergenic
1192305467 X:69954813-69954835 GAGGGTGGAAGGTGGGAGGATGG - Intronic
1192740154 X:73884305-73884327 GAGGGCGAAGGGTGGGAGGAGGG + Intergenic
1192824050 X:74676131-74676153 GAGGGTGGAAGGTGGGAGGAGGG + Intergenic
1192888989 X:75367896-75367918 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1192958126 X:76095440-76095462 CTGGGGGAAAGGGTGGCTGATGG - Intergenic
1193197388 X:78649231-78649253 CAGGGGGAAGGGTGAGAGGGTGG + Intergenic
1193203611 X:78721672-78721694 AAGGGGGAATGGTGGGAGGCGGG + Intergenic
1193252279 X:79305717-79305739 GAAGGTGAAAGGTGGGAGGAGGG + Intergenic
1193255863 X:79348451-79348473 CAGGGGAAAGGGTGGGAGTAGGG + Intergenic
1193336033 X:80290558-80290580 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1193408485 X:81133708-81133730 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1193522005 X:82541807-82541829 GAGGGTGAAGGGTGGGAGGAGGG + Intergenic
1193696616 X:84714946-84714968 GAGGGTGAAGGGTGGGAGGAGGG - Intergenic
1193859872 X:86652089-86652111 GAGGGAGAAGGGTGGGAGGAGGG - Intronic
1193894301 X:87093206-87093228 GTGGGGGGAAGGTGGGAGGAGGG - Intergenic
1194172558 X:90605636-90605658 GAGGGTGGAAGGTGGGAGGAGGG - Intergenic
1194602191 X:95935807-95935829 CAGGGGAAAGGGTGGGAGGTGGG - Intergenic
1194984400 X:100474621-100474643 CAGGGTGGAAGGTGGGAGAAAGG + Intergenic
1195306125 X:103585690-103585712 CAGGGGGAAAGGCTGGGGGTGGG + Intronic
1195477684 X:105304999-105305021 CAGGAGGAAAGGGGGAGGGAAGG + Intronic
1196005087 X:110828205-110828227 CAAGGGGAAGGGTGGGAGGAGGG + Intergenic
1196239239 X:113321670-113321692 GAGGGTGGAAGGTGGGAGGAAGG + Intergenic
1196511133 X:116513930-116513952 CTGGGGAAAAGGTGGGAGGGGGG - Intergenic
1196672655 X:118385503-118385525 GAGGGTGAAGGGTGGGAGGAGGG + Intronic
1196980935 X:121213034-121213056 CAGAGATAAAGGTGGGAGGAAGG - Intergenic
1197226547 X:123961106-123961128 AAGGGAGAAAGGAGGGCGGGGGG - Intronic
1197470811 X:126864352-126864374 AAGGGGGAATGGAGGGTGGAAGG - Intergenic
1197651604 X:129071542-129071564 GAGGGGGAAAAGAGGGAGGAAGG + Intergenic
1197982374 X:132230329-132230351 CAGAGGGGAAGGTGGGGGTAGGG - Intergenic
1198141773 X:133811284-133811306 GAGGAGGGAAGGTGGGAGGAAGG + Intronic
1198452188 X:136777982-136778004 CAGGGGGAAGGGTGGGAGTAGGG + Intronic
1198533500 X:137566496-137566518 CAGAGGGATAGGAGGGAGGAGGG - Exonic
1199293264 X:146129149-146129171 CAGGGGGAAGGGTGGGAGGGGGG - Intergenic
1199388350 X:147249457-147249479 AAGGGTGGAAGGTGGGAGGAAGG + Intergenic
1199928190 X:152491613-152491635 CAGGGAGAAAGGTGGGAAGCGGG - Intergenic
1199967572 X:152832584-152832606 CAGGGGCAAAACTGGGCAGAGGG - Intronic
1200097246 X:153670048-153670070 CAGGGGGAGGGGTTGGGGGAGGG + Exonic
1200222912 X:154400645-154400667 CTGGGGCAAAGGTGGGAGAAGGG - Intronic
1200229845 X:154438401-154438423 CAGTGGGGATGGTGGGTGGAAGG + Intronic
1200303100 X:154998381-154998403 CAAGTGGAAAGGAGGGGGGAGGG + Intronic
1200518785 Y:4183373-4183395 GAGGGTGGAAGGTGGGAGGAGGG - Intergenic
1200656844 Y:5912666-5912688 GAGGGGGAAAGGGAGGGGGAAGG + Intergenic
1200806983 Y:7443381-7443403 AGGGAGGAAAGGTGGGAGGAAGG - Intergenic
1200807005 Y:7443471-7443493 AGGGAGGAAAGGTGGGAGGAAGG - Intergenic
1201248263 Y:12028725-12028747 GAGGGGGGAGGGTGGGAGGAAGG + Intergenic