ID: 1019577479

View in Genome Browser
Species Human (GRCh38)
Location 7:1744479-1744501
Sequence GGGAGGTGCCTGCACTCTCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 237
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 221}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019577479_1019577491 4 Left 1019577479 7:1744479-1744501 CCCTGAGAGTGCAGGCACCTCCC 0: 1
1: 0
2: 1
3: 14
4: 221
Right 1019577491 7:1744506-1744528 CCGCCCCTCCATCCCTCTGGGGG 0: 1
1: 0
2: 3
3: 16
4: 238
1019577479_1019577497 15 Left 1019577479 7:1744479-1744501 CCCTGAGAGTGCAGGCACCTCCC 0: 1
1: 0
2: 1
3: 14
4: 221
Right 1019577497 7:1744517-1744539 TCCCTCTGGGGGCTGGCGCCTGG 0: 1
1: 0
2: 2
3: 27
4: 314
1019577479_1019577489 3 Left 1019577479 7:1744479-1744501 CCCTGAGAGTGCAGGCACCTCCC 0: 1
1: 0
2: 1
3: 14
4: 221
Right 1019577489 7:1744505-1744527 CCCGCCCCTCCATCCCTCTGGGG 0: 1
1: 0
2: 5
3: 34
4: 374
1019577479_1019577486 1 Left 1019577479 7:1744479-1744501 CCCTGAGAGTGCAGGCACCTCCC 0: 1
1: 0
2: 1
3: 14
4: 221
Right 1019577486 7:1744503-1744525 CTCCCGCCCCTCCATCCCTCTGG 0: 1
1: 0
2: 4
3: 45
4: 434
1019577479_1019577487 2 Left 1019577479 7:1744479-1744501 CCCTGAGAGTGCAGGCACCTCCC 0: 1
1: 0
2: 1
3: 14
4: 221
Right 1019577487 7:1744504-1744526 TCCCGCCCCTCCATCCCTCTGGG 0: 1
1: 0
2: 2
3: 24
4: 327
1019577479_1019577494 8 Left 1019577479 7:1744479-1744501 CCCTGAGAGTGCAGGCACCTCCC 0: 1
1: 0
2: 1
3: 14
4: 221
Right 1019577494 7:1744510-1744532 CCCTCCATCCCTCTGGGGGCTGG 0: 1
1: 1
2: 4
3: 33
4: 328
1019577479_1019577500 27 Left 1019577479 7:1744479-1744501 CCCTGAGAGTGCAGGCACCTCCC 0: 1
1: 0
2: 1
3: 14
4: 221
Right 1019577500 7:1744529-1744551 CTGGCGCCTGGCCCCCCACCTGG 0: 1
1: 0
2: 6
3: 85
4: 2545

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019577479 Original CRISPR GGGAGGTGCCTGCACTCTCA GGG (reversed) Exonic
901639127 1:10684505-10684527 AGGAGGTGCCTGGGCTCTCCAGG + Intronic
902492912 1:16798272-16798294 GTCAGGAGCCTGCATTCTCAGGG + Intronic
903172559 1:21563133-21563155 TGGCGGTGCCGGCACTGTCAGGG - Exonic
903554165 1:24181033-24181055 GGGAGGCTCCTGCACACTCTGGG + Intronic
903857035 1:26343698-26343720 GGGAGGTGCCTGGCCTCACCTGG - Intronic
904464233 1:30698514-30698536 AGGAGTTGCCTCCACTCTCCTGG - Intergenic
906511439 1:46412337-46412359 GGGAGGACCCTGCCCTCTCGGGG + Intronic
911074599 1:93860905-93860927 GTGGGTTGCCTGCACTCTGATGG - Intergenic
912430012 1:109624068-109624090 CGGAGCTGCCTGCACTCTGCAGG + Intronic
912450495 1:109764990-109765012 GGGAGGTGCCTTCCCTGTCTGGG + Intronic
920422621 1:205845385-205845407 GGGAGGTGCCCCCATTCTCTGGG - Exonic
921080186 1:211732929-211732951 GGGAGGTGACTGCACTATCCAGG - Intergenic
922535714 1:226379313-226379335 TTGAGGTGCTAGCACTCTCACGG + Intronic
923351818 1:233114863-233114885 GGGAAGGGCCTACACTTTCAGGG + Intronic
923527536 1:234784258-234784280 GTCAGGAGCCTGCATTCTCAGGG - Intergenic
1065316666 10:24470661-24470683 GGGAGGAGCCTGCATACTCCAGG + Intronic
1067148639 10:43711737-43711759 GGGAGGGGCCTGAGGTCTCAGGG + Intergenic
1070211774 10:74330744-74330766 TGGAGCTGGCTGCACTCACAAGG - Intronic
1070962583 10:80509493-80509515 GGGAGGTGCATGCTCTATCGGGG - Intronic
1071531173 10:86391334-86391356 GGGTGGTGCCTCCACTCTCAAGG - Intergenic
1071573292 10:86709639-86709661 GGGAAGACCCTTCACTCTCATGG - Intronic
1071778024 10:88810849-88810871 GGGAAATGCCCGGACTCTCAAGG + Intronic
1072948329 10:99830676-99830698 GGGAATTGCCTGCATGCTCAGGG + Intronic
1074157107 10:110808713-110808735 AGGAGCTGCCTGCAGTTTCAGGG - Intronic
1074895203 10:117771415-117771437 GGGAATTGCCAGCATTCTCAGGG + Intergenic
1076586874 10:131555405-131555427 GGGAGATGGCTGCACTTTGAGGG - Intergenic
1077111212 11:863013-863035 GGGCTGTGCCTGCACTCACCAGG - Intronic
1077372730 11:2191110-2191132 GGGAGGCTGCTCCACTCTCAGGG - Intergenic
1078720791 11:13881345-13881367 GGGAGAGATCTGCACTCTCAAGG - Intergenic
1079640682 11:22801258-22801280 GGGAGGTCACTGCAGTATCAAGG - Intronic
1080541191 11:33267242-33267264 GGCAGTTGCCTGTAATCTCAAGG - Intronic
1080796503 11:35568343-35568365 GGGTGATGCAAGCACTCTCATGG - Intergenic
1082780916 11:57286932-57286954 GGAAGGTGCCAGGACTATCATGG + Intergenic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1083487770 11:62994417-62994439 AGCAGGTCCCTGCACTCTCTGGG - Intronic
1088599520 11:111462412-111462434 GAGCGGGGCCTGCTCTCTCAAGG + Intergenic
1088747027 11:112812519-112812541 GGGACGTGAGTTCACTCTCAGGG - Intergenic
1089108447 11:116035209-116035231 GGGAGGAGTCTGCGCTCACATGG - Intergenic
1089213141 11:116819796-116819818 GGGAGGTGGCTAGACTCGCAGGG + Intergenic
1089787009 11:120914992-120915014 GGGAGCTCCCTGCACTCACTGGG - Intronic
1090136435 11:124204101-124204123 GGGTGATGCCAGCACTCTCTTGG + Intergenic
1090622778 11:128576147-128576169 GGGAGTTGCCAGGGCTCTCAAGG + Intronic
1090897583 11:130992047-130992069 GGGAGGTGCCATGACTCTCAGGG + Intergenic
1090929039 11:131278890-131278912 TGGAGGTGCCTGCTCTTTAAGGG + Intergenic
1091932361 12:4406298-4406320 GGGAGGTGGCTGCACTCCACAGG - Intergenic
1092731550 12:11539701-11539723 GGGAGGTCCCTGGGCTGTCACGG + Intergenic
1095133572 12:38571601-38571623 GGGCGATGCCAGCACTCTCTTGG - Intergenic
1095573689 12:43710447-43710469 GGGTGATGCCAGCACTCTCTTGG + Intergenic
1097179376 12:57162591-57162613 GGGAAGTGCCTTCACTCCCAGGG - Intronic
1100677046 12:96879420-96879442 GGGAGGGCCTGGCACTCTCAGGG - Intergenic
1103199209 12:119072780-119072802 GTGAAGTGCCTGGAATCTCAGGG - Intronic
1103518132 12:121520686-121520708 GGCAGGTCCCTGAAATCTCACGG + Intronic
1103536852 12:121639143-121639165 GGGTGGTGGCTGCCCTCCCAGGG - Intronic
1104205604 12:126635418-126635440 GGGAGGTGGCTGAAGTCTCCAGG + Intergenic
1104857072 12:131907376-131907398 GGCAGGTGCCTGCGGGCTCAGGG + Intronic
1107425459 13:40288471-40288493 GGCAGGCTCCTGTACTCTCATGG - Intergenic
1107453888 13:40536830-40536852 GGTAGGTGCCAGCAGTCACATGG - Intergenic
1109554590 13:63955488-63955510 AGGAGCTGCAGGCACTCTCATGG + Intergenic
1116269391 14:42741971-42741993 GGGTGATGCCAGCACTCTCTTGG - Intergenic
1119258578 14:73221849-73221871 AGGATGTGCCTTCACTCACACGG + Exonic
1121953478 14:98193180-98193202 TGGAGCTGCCCACACTCTCAAGG + Intergenic
1122860535 14:104580469-104580491 GAGAAGGGGCTGCACTCTCAGGG + Intronic
1122889845 14:104727203-104727225 GGGAGGTGACGACACTCTCAGGG - Intronic
1123207306 14:106726049-106726071 GGGAGGGACGTGCATTCTCAGGG - Intergenic
1123212325 14:106773043-106773065 GGGAGGGACGTGCATTCTCAGGG - Intergenic
1123874243 15:24607647-24607669 GGGAGATGCATGCTCTCTTAGGG + Intergenic
1124034177 15:26038900-26038922 GGGATGTGCCTGGCCTCACATGG + Intergenic
1124375405 15:29126172-29126194 GGGCCGGGCCTCCACTCTCAGGG + Intronic
1126944000 15:53797759-53797781 GGGTGATGCCAGCACTCTCTTGG - Intergenic
1127820215 15:62648287-62648309 GGTATGTGCCTGTAGTCTCAGGG + Intronic
1128333972 15:66774326-66774348 GGGAGCTGACTGCAGTCTGAGGG - Intronic
1129242332 15:74259110-74259132 GGGTGGTGCCTGCTGTCTCGGGG - Intronic
1129706500 15:77797624-77797646 GGAAGCTGCTTGCCCTCTCAAGG - Intronic
1129819203 15:78585320-78585342 TGGAGCTGCCTGCATCCTCAGGG + Intronic
1132331612 15:101015880-101015902 GGAGGGTGCCAGCACTGTCAGGG + Intronic
1132733740 16:1375573-1375595 GGGAGTGGCCTCCACTCCCACGG + Intronic
1132949736 16:2554476-2554498 AGGAGGTGCCTGGACCCTGATGG + Intronic
1132964612 16:2645691-2645713 AGGAGGTGCCTGGACCCTGATGG - Intergenic
1133102030 16:3485575-3485597 GGGAGGGGCCTGCCCTCACTGGG + Exonic
1134370787 16:13622247-13622269 GGGAGGAGCTTACACTCTCCTGG - Intergenic
1135550042 16:23390783-23390805 AGGAGATGCCTGCTCTGTCACGG + Intronic
1136518966 16:30784334-30784356 GGGAGGGGCCTGGACTCTGGGGG - Intronic
1136630567 16:31487372-31487394 GGGGGGCGCCTGCATCCTCATGG + Exonic
1141031308 16:80591474-80591496 GGCAGGTGCGTGCAGTCTCAAGG - Intergenic
1142362028 16:89631906-89631928 GGGTGGTCCCTGCATCCTCATGG + Intronic
1142966277 17:3583739-3583761 GAGAGGTGGAAGCACTCTCATGG + Intronic
1144678493 17:17176950-17176972 GGGAGGGGCCTGGGCACTCAGGG + Intronic
1145378179 17:22371039-22371061 GCTTGGTGCTTGCACTCTCAAGG + Intergenic
1145940926 17:28743217-28743239 GGGAGGTGGCAGCACTCCCGGGG - Exonic
1146676715 17:34778816-34778838 ATGAGCTGCCTGCATTCTCAGGG - Intergenic
1151224503 17:72638679-72638701 GGGAGCTGCCTGCCCCATCATGG + Intergenic
1151562515 17:74878208-74878230 GGCCGGTGCCTCCACTCTCCAGG + Exonic
1152711126 17:81871009-81871031 GGGAGGGGCCGGCACTCCCCTGG + Intronic
1153879028 18:9404545-9404567 GCGGGGCGCCTGCACTCTCCAGG - Intergenic
1154344122 18:13528150-13528172 GGGAAGAGCCCCCACTCTCAGGG - Intronic
1155166453 18:23236092-23236114 GGGAGGTGCCTCCATTTACATGG + Intronic
1156490015 18:37490706-37490728 GGGAGGTGTTTGCACCATCATGG - Intronic
1158474051 18:57764211-57764233 GGCAGGTGGCTGCACAGTCATGG - Intronic
1160095477 18:75868205-75868227 TGAAAGTGCTTGCACTCTCAGGG - Intergenic
1161419347 19:4167751-4167773 GGGAGGTGCCTGGGTTCTGAGGG - Intronic
1161676735 19:5655022-5655044 GGGAGGTGCTGACACTTTCAGGG - Intronic
1162199492 19:9010327-9010349 GGGAGGGCCCTGCACACCCAGGG - Intergenic
1163698760 19:18776852-18776874 GGGAGGTCCCTGCCCTCGCCAGG + Intronic
1164675556 19:30098111-30098133 AGGAGGGGCCAGCACCCTCAGGG + Intergenic
1164727468 19:30475871-30475893 GGGAGGTGCCTGCTCCTCCAGGG + Intronic
1166700634 19:44879579-44879601 GGGAGCTGCCGCCACTCCCAGGG - Intronic
1167380327 19:49134568-49134590 GGGAGCTGCCTGCAGCCCCACGG + Intronic
1168160166 19:54505153-54505175 AGGTGATGCCTGCACTCCCAGGG - Intronic
1168287071 19:55340353-55340375 GGGACCTCCCTGCACTCCCAGGG + Intronic
925020904 2:567088-567110 GGAAGGCTCCTCCACTCTCACGG + Intergenic
927636604 2:24821385-24821407 GGGAGGTTCACGCACTCACAGGG - Exonic
927848037 2:26481374-26481396 GGGAGGGGTCTGCACTGGCAGGG - Intronic
929528150 2:42725658-42725680 GAGAGGTGCCTGCACCGGCAGGG - Intronic
936151328 2:110023900-110023922 AGGATGAGCCTGCACTCTGATGG + Intergenic
936193347 2:110347469-110347491 AGGATGAGCCTGCACTCTGATGG - Intergenic
936403727 2:112184560-112184582 TTGAGGTGTCTGCACTCGCATGG + Intronic
937908857 2:127065648-127065670 GGGTGGTGGCTGCATCCTCATGG - Intronic
942087390 2:172456126-172456148 GGGAAGTGCCTGCTCTCTAAGGG - Intronic
943627966 2:190219721-190219743 GGGAGGGTCCTGCACACTAAGGG + Intronic
948664967 2:239529002-239529024 GAGAGGCACCTGCACTCACATGG - Intergenic
1170303982 20:14917466-14917488 GCCAAGTGCCTGCACTATCATGG - Intronic
1170566782 20:17612110-17612132 GGGAGGTACCTTCACTTCCATGG + Intergenic
1171855613 20:30340184-30340206 GCTTGGTGCTTGCACTCTCAAGG - Intergenic
1173548574 20:43916571-43916593 GGGAGCTGCCTCCAGTCTGATGG + Intronic
1176060364 20:63169857-63169879 GGGAGGTGCCTGCATTCCGAAGG - Intergenic
1176917494 21:14644194-14644216 GGGTGATGCCTGCACTCCCTTGG - Intronic
1177903421 21:26946015-26946037 GGGAGAGGCATGCTCTCTCAAGG + Intronic
1179092855 21:38283985-38284007 GGGAAGCTCCTGCACTTTCATGG + Intronic
1179916804 21:44482967-44482989 GGGAGGGACCTGCACACTAAGGG + Intergenic
1180573652 22:16752521-16752543 GTTTGGTGCTTGCACTCTCAAGG - Intergenic
1180599573 22:17007484-17007506 GTGAGGTGCCTGCCTTCTCGGGG + Intronic
1184979530 22:48086065-48086087 GGGAGGGGCCTGCACACTAGGGG - Intergenic
1185272009 22:49934143-49934165 GGAAGGGGCCTGCACTCTTGGGG - Intergenic
949460506 3:4288059-4288081 AGCAGGTGCCTGAACTCTCTGGG - Intronic
950563196 3:13747955-13747977 GGGAAGCGCCTGCCCTCTCTGGG + Intergenic
950687485 3:14628916-14628938 GGCTGGTGCCTGAACTCTCTTGG - Intergenic
952295004 3:32053840-32053862 GGCATGTGCCTGTAATCTCAAGG + Intronic
953028010 3:39155985-39156007 TAGAGGTGACTCCACTCTCAGGG + Intergenic
953537665 3:43788400-43788422 GGGAGATGTCTGTATTCTCATGG + Intergenic
954075981 3:48180779-48180801 CGTGGCTGCCTGCACTCTCATGG - Exonic
954871607 3:53771498-53771520 GGGTGGTGCAGGCACTCACAAGG + Intronic
954882789 3:53846764-53846786 GGGGCATGCCTGCACCCTCAGGG + Intronic
956796507 3:72723042-72723064 GGGTGGGGCCTGCACGCCCATGG + Intergenic
958910524 3:99988846-99988868 GGCAGGTGCCTTCATTCTCCTGG + Intronic
961639376 3:128355309-128355331 AGGAGGTGCCTGCAATGTCGGGG + Intronic
961731802 3:128970868-128970890 GGGAAGTGCCTGCACCCAGAGGG + Exonic
962151863 3:132902251-132902273 GGGTGGTGCCAGCACTCCCTTGG - Intergenic
965860714 3:173146628-173146650 GGGAGATGCCGGCACTCCCTTGG - Intergenic
965892597 3:173533439-173533461 GGGAGTTGCCTGCATACTCATGG - Intronic
966456890 3:180127855-180127877 GGGAGGTGCCAGCTTTTTCACGG - Intergenic
968218578 3:196915655-196915677 GGGTGGTGCAAGCACTCCCATGG - Intronic
968732552 4:2276412-2276434 GGGAGGGGCCTTCACTGTCCAGG + Intronic
969078355 4:4598832-4598854 GGGATATGCCTCCACTCCCAAGG + Intergenic
969228768 4:5815650-5815672 GGGAGGGGCTTCCACTCTCTGGG - Intronic
969512105 4:7623965-7623987 GGGTGGTGACTGCCCTCTCTGGG + Intronic
971476771 4:27080087-27080109 GGAAGGTGCCTGCACAGACAAGG + Intergenic
972675795 4:41257862-41257884 GGGAGGAGCCTGCATTTTCGTGG + Intronic
976468715 4:85401914-85401936 GGGAGGTGACTGCACTGTGGTGG + Intergenic
980306348 4:131065398-131065420 GCCAGGTGTCTGCACACTCAGGG - Intergenic
980538333 4:134159811-134159833 GGGTGATGCAGGCACTCTCAGGG - Intergenic
985626951 5:994058-994080 GGGAGGTACCTGCAGGCTCCAGG + Intergenic
992614495 5:78535547-78535569 GGGAGGGGCCTTCTCTCTCCTGG - Intronic
997120442 5:131167710-131167732 GGGAGGTTCCTGCATTATCTAGG + Intronic
997284682 5:132669612-132669634 GGTGGGTGCCTGCATTGTCAGGG - Intergenic
997733330 5:136196015-136196037 GGAACGTGACTGCCCTCTCAGGG - Intergenic
1001269988 5:170303640-170303662 GGGATGTGCTTGCACTTTCTGGG - Intergenic
1001415768 5:171544010-171544032 GGCAGGTCACTGCACTCTCTGGG + Intergenic
1001488895 5:172141664-172141686 GGGAGGTGCCTGCTCTACCTGGG + Intronic
1002581296 5:180210922-180210944 GGCAGCTGCCTGCTCTCTCCAGG - Intergenic
1002759041 6:187629-187651 GGGAGGAGCCTGCACACTAGTGG + Intergenic
1004623500 6:17352549-17352571 GGCATGTGCCTGCAGTCCCAGGG - Intergenic
1009558258 6:65203053-65203075 GGGCAGTGCCTGGACTCTCAGGG - Intronic
1009966513 6:70584146-70584168 GGCAGGTGCCTGTAATCCCAGGG - Intronic
1013313230 6:108917269-108917291 GGGAGGTGTCTGCAGGCTTAGGG - Intronic
1015069449 6:129073487-129073509 GGGATGTGACTGAAGTCTCAGGG - Intronic
1017587854 6:155946969-155946991 TGGACATTCCTGCACTCTCAGGG + Intergenic
1019148744 6:169990590-169990612 GGCAGTTGCCTGCAATCTCCTGG + Intergenic
1019427832 7:985651-985673 GGAAGGTGCCTGGACTGTCAGGG - Intronic
1019499800 7:1359142-1359164 GGGATGTGCCTGCAGGCTCAGGG - Intergenic
1019577479 7:1744479-1744501 GGGAGGTGCCTGCACTCTCAGGG - Exonic
1019906969 7:4072231-4072253 TGGAGGTGCCTGTGCTGTCAGGG + Intronic
1019996187 7:4725806-4725828 GCAAGGTGCCTGCACTCAGAGGG + Intronic
1020116497 7:5479401-5479423 GGGAGGTTCCCGGACCCTCAGGG - Intronic
1020122562 7:5513367-5513389 CGGAGGAGCCTGGACCCTCAGGG + Intronic
1020127303 7:5540133-5540155 GAGAGGTGCCTGGCCTCCCAAGG - Intronic
1021343219 7:19489527-19489549 TGGACATTCCTGCACTCTCAAGG - Intergenic
1022016899 7:26357909-26357931 GAGAGGTGCCTGCACTGGGATGG + Intronic
1022370380 7:29765578-29765600 GTGAAATGCCTGCAGTCTCAGGG + Intergenic
1023041432 7:36176163-36176185 GGGTGGGGCCTGGCCTCTCAGGG + Intronic
1024287810 7:47774410-47774432 TGGAGGTGCCTCCAGTGTCATGG - Intronic
1024417645 7:49125833-49125855 GTCAGGAGCCTGTACTCTCAGGG + Intergenic
1025020000 7:55473221-55473243 GGCAGGTCCCTGCCCTCTCGGGG + Intronic
1025300382 7:57815212-57815234 GCTTGGTGCTTGCACTCTCAAGG + Intergenic
1026614897 7:71893145-71893167 GGAAGGATCCTGCACCCTCAGGG + Intronic
1028354607 7:89890741-89890763 TGGAGCTGCCTCCATTCTCAGGG - Intergenic
1033913415 7:146292656-146292678 GAGAGATGTCTGCACTCCCATGG + Intronic
1034536468 7:151728784-151728806 GCGAGGTGCGTGCTCTCCCAGGG - Intronic
1035627709 8:1084834-1084856 TGGAGATGCCTGCACTCCCATGG - Intergenic
1038249160 8:25886843-25886865 GGGAGGAGTCTGTACTCTGATGG + Exonic
1039920349 8:41889364-41889386 GGGAGGTGCCTGCACTTATGAGG - Intronic
1046533296 8:115474887-115474909 GGGAGAAGCCTGCACCATCATGG - Intronic
1048316002 8:133362628-133362650 GAAAGTTGCCTTCACTCTCATGG + Intergenic
1048988106 8:139746189-139746211 GGCAGTTCCCTGCTCTCTCATGG + Intronic
1049231687 8:141488144-141488166 GGGAGGGGACTGCAGTCACAGGG - Intergenic
1049368721 8:142253399-142253421 CGGGGGTGACTGCACCCTCAGGG - Intronic
1049371433 8:142269750-142269772 GGGCGGGGCCTCCACTCTGATGG - Intronic
1049385577 8:142341428-142341450 GGGATGTGCCTGCAGCCCCAAGG - Intronic
1052254568 9:26439411-26439433 GAGAGGTGCCTGCTTTCTGAAGG + Intergenic
1053793436 9:41703475-41703497 GCTTGGTGCTTGCACTCTCAAGG - Intergenic
1054151740 9:61611355-61611377 GCTTGGTGCTTGCACTCTCAAGG + Intergenic
1054181845 9:61915490-61915512 GCTTGGTGCTTGCACTCTCAAGG - Intergenic
1054471512 9:65542494-65542516 GCTTGGTGCTTGCACTCTCAAGG + Intergenic
1055104009 9:72493609-72493631 GAGAGGTGCCGGCATGCTCAAGG - Intergenic
1055373501 9:75624913-75624935 GTGAGGTGGCTGCACTGTGATGG + Intergenic
1056544606 9:87603168-87603190 AGGAGGGGCCTGGACTCTAAAGG + Intronic
1057214366 9:93219899-93219921 TGGATGCGCCTGCACTCTCCAGG - Intronic
1057238206 9:93383332-93383354 GGCAGGTGCCTGTACTCTGGAGG + Intergenic
1057483151 9:95461562-95461584 GGAAAGAGCCTGCACTCTCTTGG + Intronic
1058745132 9:107983091-107983113 GGGAGTTGCCTGTACACACAAGG - Intergenic
1058829308 9:108800946-108800968 GTGGGGTGCCTGCAATCCCAAGG - Intergenic
1058857746 9:109081551-109081573 GGGAGGTGAATGCACAATCAAGG + Intronic
1059321939 9:113476725-113476747 GGCAGGTGCCTGCCCTCACAGGG - Intronic
1059330766 9:113534073-113534095 GGGAAGTGCCCCCACTCTGAAGG + Intronic
1059408344 9:114116330-114116352 GGGAGTGGCCTGCCCTCTCCTGG - Intergenic
1059432129 9:114256629-114256651 GGTAGCTGCCTGCTCTCGCAAGG - Intronic
1060879070 9:127105036-127105058 GGGAGGGTCCTGCCCTCTCCTGG - Intronic
1062666063 9:137673169-137673191 GGGAGGTTCCTACACACTCTAGG - Intronic
1185650406 X:1643527-1643549 GGCAAATGCCCGCACTCTCATGG - Intergenic
1189279894 X:39813642-39813664 GGGAGGTGCCAGCAGGCCCACGG + Intergenic
1189331655 X:40148030-40148052 AGCTGGTGCCTCCACTCTCAGGG + Intronic
1189982450 X:46524562-46524584 GGCAGGTGCCTGTAATCCCAGGG + Intronic
1193305389 X:79944609-79944631 GGGATGTGTCTGCACTGGCAGGG + Intergenic
1193815668 X:86102177-86102199 GGGTGATGCCAGCACTCTCTTGG - Intergenic
1194835170 X:98672720-98672742 GGGTGATGCCAGCACTCTCTTGG + Intergenic
1196609494 X:117695402-117695424 GGGTGATGCCTGCACTCTCTTGG - Intergenic
1199247608 X:145625155-145625177 GGGAGATGCCAGCACTCCCTTGG - Intergenic
1199806770 X:151307971-151307993 GGCAGGTGCCTCTTCTCTCATGG - Intergenic