ID: 1019579325

View in Genome Browser
Species Human (GRCh38)
Location 7:1752277-1752299
Sequence CATGGTGGCCCCTCTGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019579325_1019579344 16 Left 1019579325 7:1752277-1752299 CCCCACCCAGAGGGGCCACCATG No data
Right 1019579344 7:1752316-1752338 CGGCCTGCTGAGACCAGGGATGG No data
1019579325_1019579335 -10 Left 1019579325 7:1752277-1752299 CCCCACCCAGAGGGGCCACCATG No data
Right 1019579335 7:1752290-1752312 GGCCACCATGGGGCAGTGAGGGG No data
1019579325_1019579348 21 Left 1019579325 7:1752277-1752299 CCCCACCCAGAGGGGCCACCATG No data
Right 1019579348 7:1752321-1752343 TGCTGAGACCAGGGATGGGGCGG No data
1019579325_1019579339 -4 Left 1019579325 7:1752277-1752299 CCCCACCCAGAGGGGCCACCATG No data
Right 1019579339 7:1752296-1752318 CATGGGGCAGTGAGGGGGCCCGG No data
1019579325_1019579341 12 Left 1019579325 7:1752277-1752299 CCCCACCCAGAGGGGCCACCATG No data
Right 1019579341 7:1752312-1752334 GGCCCGGCCTGCTGAGACCAGGG No data
1019579325_1019579346 18 Left 1019579325 7:1752277-1752299 CCCCACCCAGAGGGGCCACCATG No data
Right 1019579346 7:1752318-1752340 GCCTGCTGAGACCAGGGATGGGG No data
1019579325_1019579336 -9 Left 1019579325 7:1752277-1752299 CCCCACCCAGAGGGGCCACCATG No data
Right 1019579336 7:1752291-1752313 GCCACCATGGGGCAGTGAGGGGG No data
1019579325_1019579340 11 Left 1019579325 7:1752277-1752299 CCCCACCCAGAGGGGCCACCATG No data
Right 1019579340 7:1752311-1752333 GGGCCCGGCCTGCTGAGACCAGG No data
1019579325_1019579349 28 Left 1019579325 7:1752277-1752299 CCCCACCCAGAGGGGCCACCATG No data
Right 1019579349 7:1752328-1752350 ACCAGGGATGGGGCGGAGCCAGG No data
1019579325_1019579345 17 Left 1019579325 7:1752277-1752299 CCCCACCCAGAGGGGCCACCATG No data
Right 1019579345 7:1752317-1752339 GGCCTGCTGAGACCAGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019579325 Original CRISPR CATGGTGGCCCCTCTGGGTG GGG (reversed) Intergenic
No off target data available for this crispr