ID: 1019581437

View in Genome Browser
Species Human (GRCh38)
Location 7:1765488-1765510
Sequence CCATTGTCACACAAAGCACG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019581437_1019581442 4 Left 1019581437 7:1765488-1765510 CCTCGTGCTTTGTGTGACAATGG No data
Right 1019581442 7:1765515-1765537 TTTGCAGACATGACTCAGGCAGG No data
1019581437_1019581441 0 Left 1019581437 7:1765488-1765510 CCTCGTGCTTTGTGTGACAATGG No data
Right 1019581441 7:1765511-1765533 GGACTTTGCAGACATGACTCAGG No data
1019581437_1019581443 5 Left 1019581437 7:1765488-1765510 CCTCGTGCTTTGTGTGACAATGG No data
Right 1019581443 7:1765516-1765538 TTGCAGACATGACTCAGGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019581437 Original CRISPR CCATTGTCACACAAAGCACG AGG (reversed) Intergenic
No off target data available for this crispr