ID: 1019584194

View in Genome Browser
Species Human (GRCh38)
Location 7:1787876-1787898
Sequence CAGGTGCTGTAGAGGAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019584194_1019584208 25 Left 1019584194 7:1787876-1787898 CCCTTTTTCCTCTACAGCACCTG No data
Right 1019584208 7:1787924-1787946 ACGGAGGAGCGCCACATTGGGGG No data
1019584194_1019584202 1 Left 1019584194 7:1787876-1787898 CCCTTTTTCCTCTACAGCACCTG No data
Right 1019584202 7:1787900-1787922 CGGGCACAGGCGCTCTCATCAGG No data
1019584194_1019584204 9 Left 1019584194 7:1787876-1787898 CCCTTTTTCCTCTACAGCACCTG No data
Right 1019584204 7:1787908-1787930 GGCGCTCTCATCAGGCACGGAGG No data
1019584194_1019584205 22 Left 1019584194 7:1787876-1787898 CCCTTTTTCCTCTACAGCACCTG No data
Right 1019584205 7:1787921-1787943 GGCACGGAGGAGCGCCACATTGG No data
1019584194_1019584203 6 Left 1019584194 7:1787876-1787898 CCCTTTTTCCTCTACAGCACCTG No data
Right 1019584203 7:1787905-1787927 ACAGGCGCTCTCATCAGGCACGG No data
1019584194_1019584206 23 Left 1019584194 7:1787876-1787898 CCCTTTTTCCTCTACAGCACCTG No data
Right 1019584206 7:1787922-1787944 GCACGGAGGAGCGCCACATTGGG No data
1019584194_1019584207 24 Left 1019584194 7:1787876-1787898 CCCTTTTTCCTCTACAGCACCTG No data
Right 1019584207 7:1787923-1787945 CACGGAGGAGCGCCACATTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019584194 Original CRISPR CAGGTGCTGTAGAGGAAAAA GGG (reversed) Intergenic
No off target data available for this crispr