ID: 1019584492

View in Genome Browser
Species Human (GRCh38)
Location 7:1790483-1790505
Sequence CACGCCCAGCTCATTTTTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019584492_1019584500 22 Left 1019584492 7:1790483-1790505 CCCCAAAAAATGAGCTGGGCGTG No data
Right 1019584500 7:1790528-1790550 GCTACTCACAAGGCTGAGATGGG No data
1019584492_1019584501 25 Left 1019584492 7:1790483-1790505 CCCCAAAAAATGAGCTGGGCGTG No data
Right 1019584501 7:1790531-1790553 ACTCACAAGGCTGAGATGGGAGG No data
1019584492_1019584499 21 Left 1019584492 7:1790483-1790505 CCCCAAAAAATGAGCTGGGCGTG No data
Right 1019584499 7:1790527-1790549 AGCTACTCACAAGGCTGAGATGG No data
1019584492_1019584497 12 Left 1019584492 7:1790483-1790505 CCCCAAAAAATGAGCTGGGCGTG No data
Right 1019584497 7:1790518-1790540 TGTAGTCCAAGCTACTCACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019584492 Original CRISPR CACGCCCAGCTCATTTTTTG GGG (reversed) Intergenic
No off target data available for this crispr