ID: 1019588292

View in Genome Browser
Species Human (GRCh38)
Location 7:1816331-1816353
Sequence CAGTCTGAGGACCTGGACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 2, 1: 0, 2: 4, 3: 27, 4: 263}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019588268_1019588292 27 Left 1019588268 7:1816281-1816303 CCCTCTCCCCTCCCTCCCTACAC 0: 2
1: 2
2: 18
3: 304
4: 2952
Right 1019588292 7:1816331-1816353 CAGTCTGAGGACCTGGACAGGGG 0: 2
1: 0
2: 4
3: 27
4: 263
1019588284_1019588292 -3 Left 1019588284 7:1816311-1816333 CCAGCCATGGGGGCTTCCCTCAG 0: 2
1: 1
2: 3
3: 28
4: 285
Right 1019588292 7:1816331-1816353 CAGTCTGAGGACCTGGACAGGGG 0: 2
1: 0
2: 4
3: 27
4: 263
1019588270_1019588292 21 Left 1019588270 7:1816287-1816309 CCCCTCCCTCCCTACACAGCCCC 0: 1
1: 6
2: 10
3: 130
4: 1138
Right 1019588292 7:1816331-1816353 CAGTCTGAGGACCTGGACAGGGG 0: 2
1: 0
2: 4
3: 27
4: 263
1019588272_1019588292 19 Left 1019588272 7:1816289-1816311 CCTCCCTCCCTACACAGCCCCTC 0: 1
1: 1
2: 14
3: 171
4: 1049
Right 1019588292 7:1816331-1816353 CAGTCTGAGGACCTGGACAGGGG 0: 2
1: 0
2: 4
3: 27
4: 263
1019588274_1019588292 15 Left 1019588274 7:1816293-1816315 CCTCCCTACACAGCCCCTCCAGC 0: 1
1: 1
2: 3
3: 62
4: 627
Right 1019588292 7:1816331-1816353 CAGTCTGAGGACCTGGACAGGGG 0: 2
1: 0
2: 4
3: 27
4: 263
1019588275_1019588292 12 Left 1019588275 7:1816296-1816318 CCCTACACAGCCCCTCCAGCCAT 0: 1
1: 1
2: 2
3: 37
4: 308
Right 1019588292 7:1816331-1816353 CAGTCTGAGGACCTGGACAGGGG 0: 2
1: 0
2: 4
3: 27
4: 263
1019588273_1019588292 16 Left 1019588273 7:1816292-1816314 CCCTCCCTACACAGCCCCTCCAG 0: 1
1: 2
2: 3
3: 55
4: 587
Right 1019588292 7:1816331-1816353 CAGTCTGAGGACCTGGACAGGGG 0: 2
1: 0
2: 4
3: 27
4: 263
1019588276_1019588292 11 Left 1019588276 7:1816297-1816319 CCTACACAGCCCCTCCAGCCATG 0: 1
1: 1
2: 6
3: 49
4: 371
Right 1019588292 7:1816331-1816353 CAGTCTGAGGACCTGGACAGGGG 0: 2
1: 0
2: 4
3: 27
4: 263
1019588283_1019588292 0 Left 1019588283 7:1816308-1816330 CCTCCAGCCATGGGGGCTTCCCT 0: 2
1: 1
2: 0
3: 32
4: 436
Right 1019588292 7:1816331-1816353 CAGTCTGAGGACCTGGACAGGGG 0: 2
1: 0
2: 4
3: 27
4: 263
1019588269_1019588292 26 Left 1019588269 7:1816282-1816304 CCTCTCCCCTCCCTCCCTACACA 0: 3
1: 0
2: 17
3: 250
4: 2172
Right 1019588292 7:1816331-1816353 CAGTCTGAGGACCTGGACAGGGG 0: 2
1: 0
2: 4
3: 27
4: 263
1019588271_1019588292 20 Left 1019588271 7:1816288-1816310 CCCTCCCTCCCTACACAGCCCCT 0: 1
1: 2
2: 11
3: 189
4: 1166
Right 1019588292 7:1816331-1816353 CAGTCTGAGGACCTGGACAGGGG 0: 2
1: 0
2: 4
3: 27
4: 263
1019588285_1019588292 -7 Left 1019588285 7:1816315-1816337 CCATGGGGGCTTCCCTCAGTCTG 0: 2
1: 1
2: 1
3: 18
4: 231
Right 1019588292 7:1816331-1816353 CAGTCTGAGGACCTGGACAGGGG 0: 2
1: 0
2: 4
3: 27
4: 263
1019588282_1019588292 1 Left 1019588282 7:1816307-1816329 CCCTCCAGCCATGGGGGCTTCCC 0: 1
1: 0
2: 1
3: 29
4: 230
Right 1019588292 7:1816331-1816353 CAGTCTGAGGACCTGGACAGGGG 0: 2
1: 0
2: 4
3: 27
4: 263
1019588281_1019588292 2 Left 1019588281 7:1816306-1816328 CCCCTCCAGCCATGGGGGCTTCC 0: 1
1: 0
2: 7
3: 36
4: 311
Right 1019588292 7:1816331-1816353 CAGTCTGAGGACCTGGACAGGGG 0: 2
1: 0
2: 4
3: 27
4: 263

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019588292 Original CRISPR CAGTCTGAGGACCTGGACAG GGG Intronic
900373377 1:2342345-2342367 CAGGCGCAGGACCTGGCCAGGGG + Intronic
900685570 1:3945763-3945785 CAAGCTGAGGCCCTGGTCAGCGG - Intergenic
900816283 1:4848860-4848882 CTGTCAGTGCACCTGGACAGAGG - Intergenic
901041747 1:6368358-6368380 CACTTTGGGGACCTGGACTGCGG - Intronic
901102259 1:6727980-6728002 CATTCTGAGGTCCTGGGCATAGG - Intergenic
901537662 1:9893061-9893083 CAGTCTGAAGGCAAGGACAGTGG + Intronic
902220496 1:14961449-14961471 CAGGCTGAGCATGTGGACAGCGG - Intronic
902436130 1:16399034-16399056 CAGACTGTGCACCTGGGCAGAGG - Intronic
902919081 1:19655986-19656008 CAGTCAGGGGGCCTGGAAAGGGG - Intronic
903249883 1:22045109-22045131 CAGACAGAGGGCCTGGAGAGGGG + Intergenic
903682782 1:25108276-25108298 AAGTCTGGGGACAGGGACAGTGG + Intergenic
904382960 1:30124009-30124031 CACCCAGAGGACCCGGACAGTGG + Intergenic
904590759 1:31614200-31614222 AAGGCTGAGGACCTGGATATGGG + Intergenic
904653857 1:32027330-32027352 CAGTCTGAGAACTTAGAAAGTGG + Intronic
905126244 1:35718087-35718109 CATTCTGAGGCCCTGGAGGGAGG + Intronic
905707511 1:40072383-40072405 CTGTCTAAGCACCTGAACAGAGG + Exonic
906202086 1:43966828-43966850 CTGTCTGAAGTCCTGGGCAGGGG - Intronic
906608293 1:47185904-47185926 CAGTCTGCAGGCCTGGAGAGTGG - Intronic
906945178 1:50289014-50289036 CATTGTGAGGACATGGACACAGG + Intergenic
914405043 1:147362286-147362308 CATTCTGAGCAGCTTGACAGAGG + Intergenic
914846478 1:151286571-151286593 CAGTCTGAGGCCCTGGCTGGAGG + Exonic
915445193 1:155970566-155970588 AAGTCAGAGGACCTGGACTGGGG + Intronic
915938758 1:160104988-160105010 CAGTCTGAAGGCCAGGACATTGG + Intergenic
916247061 1:162698776-162698798 CAGTCTGAGGGGCTGTACAGAGG + Intronic
919748215 1:201021669-201021691 CAGCCTGGAGACCTGAACAGAGG + Intronic
920535790 1:206735824-206735846 CAGTCTGGGGACCAAGACATGGG + Intergenic
922747084 1:228050447-228050469 CAGCCTGAGGCCCTTGCCAGAGG + Intronic
923522128 1:234743331-234743353 CAGGCTTAGGACATGGACAGGGG + Intergenic
924799489 1:247317333-247317355 AAGCCACAGGACCTGGACAGGGG + Intronic
1062969180 10:1633039-1633061 GAGTCTGAGGCCCTGGGGAGAGG - Intronic
1064252528 10:13717804-13717826 CAGTCCGATGACCTCCACAGAGG - Intronic
1064615518 10:17151401-17151423 CAGTCACAGAACCAGGACAGAGG + Intronic
1067082332 10:43218704-43218726 CAGTCTCAGGGCCTGGCCAAGGG + Intronic
1067779477 10:49189238-49189260 CAGGCTAAGGACCTGGACATGGG - Intergenic
1069486292 10:68826211-68826233 CAGACTGAGGACCCAGACTGAGG - Intergenic
1070305637 10:75237559-75237581 CAGGCTGAGGACTTACACAGGGG + Intergenic
1071457798 10:85864121-85864143 CTGTCTGAGGATTTGGTCAGAGG - Intronic
1075726090 10:124611630-124611652 GAGGCTGTGGACCTGGACGGGGG - Intronic
1075929679 10:126285110-126285132 CAGACTGAGAGACTGGACAGAGG + Intronic
1076526807 10:131117245-131117267 CAGTATGAGGACCTGGAGTGAGG - Intronic
1076543872 10:131231058-131231080 TAGTATGAGGACCTGGAGGGGGG + Intronic
1076717487 10:132373798-132373820 CAGTCTGAGGACTTGGCCAGTGG + Intronic
1076852135 10:133098492-133098514 CTGTCCGAGGACCCGGTCAGGGG - Intronic
1078064059 11:8066418-8066440 CAGGCTGTGGAGCTGTACAGGGG - Intronic
1078549053 11:12268073-12268095 CAGTCTGAGGTCCAGGCCAGAGG - Intergenic
1083491873 11:63019651-63019673 CAGTCTGGGGAGCAGGACAGGGG - Intergenic
1083580711 11:63823478-63823500 CCTTCTGAGGACCTTGCCAGAGG + Intronic
1084767096 11:71319381-71319403 GGGTCTGAGCATCTGGACAGTGG - Intergenic
1084966756 11:72748797-72748819 CAGTCTGGGGGCCTGGCCAGGGG + Intronic
1085540407 11:77262627-77262649 CAGTTTGAGGACCCCCACAGAGG + Intronic
1086662498 11:89437509-89437531 CAGACTGATGACCTGGGAAGTGG + Intronic
1088781357 11:113136900-113136922 CAGACTGGGGACATGGAGAGAGG + Intronic
1089049335 11:115533005-115533027 GAGTCTGAGGGTCTGGAGAGGGG - Intergenic
1090409171 11:126495787-126495809 CAGCCTGAGGATCAGGACACTGG + Intronic
1093915892 12:24802142-24802164 CAGTCTGTGGACCTGGACAATGG - Intergenic
1094402854 12:30081129-30081151 CACTCTGAGGACCATGACAGGGG + Intergenic
1094483927 12:30909026-30909048 GACTCTGTGGACCTTGACAGTGG + Intergenic
1096069492 12:48767092-48767114 CCCTCTGAGGACCTGGATACTGG - Exonic
1096080676 12:48830374-48830396 AAGAGTGAGGACCTGGAAAGAGG + Exonic
1098659730 12:73076569-73076591 CTTTCTGAGGACCTGGAGAGAGG + Intergenic
1100639696 12:96470768-96470790 CAGACAAAGGACCTGGAAAGGGG - Intergenic
1104076125 12:125391612-125391634 CAGTCTGTGTGCGTGGACAGTGG + Intronic
1104940084 12:132390945-132390967 CTGTGTTAGGGCCTGGACAGGGG - Intergenic
1105652785 13:22398225-22398247 CAGTCTGATGAGCTGAGCAGAGG - Intergenic
1106942295 13:34792313-34792335 CAGGATGAGGAGCTGGAAAGGGG - Intergenic
1107024028 13:35781332-35781354 CAGTCTATGGACCTGGAAATTGG - Intronic
1107158124 13:37193656-37193678 CAGGCAGAGGACCTGGTGAGGGG + Intergenic
1107299314 13:38948484-38948506 TGGACTGAGGACCTGGACAGTGG - Intergenic
1107304004 13:38998758-38998780 CTGTTGGAGGAACTGGACAGTGG - Intergenic
1107664825 13:42677899-42677921 CAGTTTGAAGACCTCCACAGAGG - Intergenic
1107715479 13:43195376-43195398 CAGTCAGAAGAGCTGGACGGTGG - Intergenic
1108442483 13:50469443-50469465 CAGTCTGAGATCAGGGACAGCGG - Intronic
1108947721 13:56044459-56044481 CAGGCTGAGGAACAGGAAAGAGG - Intergenic
1113207781 13:107937548-107937570 TTGTCTGAGAACCAGGACAGGGG + Intergenic
1114456005 14:22853856-22853878 CAGGGTGAGGACGAGGACAGGGG - Intergenic
1116070957 14:40045134-40045156 GAGCCTGAGGGCCTGGGCAGTGG + Intergenic
1116694876 14:48160577-48160599 CAATCAAAAGACCTGGACAGTGG + Intergenic
1119544005 14:75458941-75458963 CAGGCTGAGGCCCAGGTCAGGGG - Intronic
1120958141 14:90101091-90101113 CAGACTGAGAAACTGAACAGGGG - Intronic
1122680983 14:103462832-103462854 GAGGCTGAGGACCTTGAAAGAGG - Intronic
1123046324 14:105518217-105518239 CTGTATGAGGACAGGGACAGAGG - Intergenic
1126866499 15:52942807-52942829 CAGTCTGGGTACCTGGGGAGTGG + Intergenic
1127703865 15:61528099-61528121 CAGTCTCAGGACCAGGACCCGGG + Intergenic
1129409384 15:75340502-75340524 TAGCCTGAGGACATGGCCAGGGG - Intronic
1129457874 15:75685306-75685328 CAGGCTGAGGCCCAGGAGAGTGG + Exonic
1129466355 15:75726226-75726248 CACCCTTAGGACCTGGGCAGGGG + Intronic
1130396008 15:83502221-83502243 CAGTGTGTGGAAATGGACAGCGG + Intronic
1130654183 15:85780446-85780468 CAGTCTGAGGACCTGGAGGGAGG + Intronic
1130726135 15:86441628-86441650 CAGTGTGTGTACTTGGACAGGGG + Intronic
1133281388 16:4667346-4667368 CAGTCTGTGGTCCTGGACCCGGG - Intronic
1134686110 16:16159713-16159735 CAGTCTGAGGACCTGGGCCCAGG + Intronic
1135694597 16:24575275-24575297 CAGACTGGGCAGCTGGACAGAGG + Intergenic
1135769755 16:25208463-25208485 CTGTCTGAAGACTTGAACAGTGG + Intergenic
1136599670 16:31276660-31276682 CTGTCTGAGTACCTGTAAAGAGG - Exonic
1137642816 16:50047810-50047832 CAGTCTTGGGACCGGGAAAGAGG - Intergenic
1138351703 16:56349437-56349459 CAGCCCGAGGCCCTGGACACAGG + Intronic
1139489750 16:67279823-67279845 CCGACGGGGGACCTGGACAGAGG + Exonic
1139586756 16:67908929-67908951 CAGTCGGGGGACCGGGGCAGGGG - Exonic
1141420992 16:83915434-83915456 TAGGCTGAGGACCTGCTCAGAGG - Exonic
1142058490 16:88015258-88015280 CAGGCAGAGGGCATGGACAGAGG - Intronic
1142187190 16:88700167-88700189 CAGCCTGTTGCCCTGGACAGTGG - Intronic
1142476935 17:194226-194248 CAGGAGGAGGCCCTGGACAGTGG - Intergenic
1143381774 17:6501189-6501211 CCTTCTGAGCACCTGGCCAGAGG - Intronic
1143781181 17:9230509-9230531 CAGTCTGAGGTCGTGGAATGCGG + Intronic
1144241746 17:13319448-13319470 CAGTCTTAGGCCAGGGACAGTGG - Intergenic
1144755781 17:17679970-17679992 TAGCTTGAGAACCTGGACAGGGG + Intergenic
1145240605 17:21239110-21239132 CAGTGTGAGTACATGGTCAGGGG + Exonic
1146487369 17:33254296-33254318 CAGTATGAGGACAGGGACAGGGG - Intronic
1146559751 17:33857961-33857983 AAGCCTGAGGAGCTGGACAGAGG - Intronic
1147314617 17:39613698-39613720 CAGTCTGAGGAGGTGGACTTGGG + Intergenic
1147876147 17:43622067-43622089 CAGTCTGAGCACCTTGGCAGAGG - Intergenic
1148854093 17:50569295-50569317 CAGGGTGAGGACCTGGGCTGGGG + Exonic
1150426105 17:65078351-65078373 CATCCTGAGGACCTGGACAGGGG + Intergenic
1153291053 18:3501768-3501790 CAGCCTGGGGAGCTGGACATTGG + Intronic
1160579947 18:79877971-79877993 CAGTCTCAGGACGTGGCCACAGG - Intronic
1161630610 19:5353349-5353371 CACTCTGGGGCCCTGGAGAGGGG + Intergenic
1161968378 19:7561555-7561577 ATGCCTGAGGACCTCGACAGGGG + Exonic
1162042633 19:7979836-7979858 CAGTCTGAAGGCAGGGACAGAGG + Intronic
1162326331 19:10001970-10001992 CAGTCCGGGGACAGGGACAGAGG + Intronic
1163041488 19:14606238-14606260 CAGTATGAGGCTCTGCACAGTGG + Intronic
1164713108 19:30373239-30373261 CAGGATGAGGGCCTGGCCAGTGG - Intronic
1164861246 19:31563913-31563935 AAGAGTGAGGAGCTGGACAGAGG + Intergenic
1165374190 19:35430023-35430045 CAGGCTGAACACCTGGAGAGGGG + Intergenic
1165757722 19:38304122-38304144 AGGGCTGAGGACCAGGACAGAGG + Intronic
1168056576 19:53868086-53868108 AGGGCTGAGGACCTGGACTGTGG + Intronic
925055226 2:852081-852103 CAGCCTGGGGCCCTGGGCAGAGG + Intergenic
925058267 2:871903-871925 CAGCCTGGGGTCCTGGGCAGAGG + Intergenic
926217566 2:10914738-10914760 CAGTCTTTGGACCAGGAGAGGGG + Intergenic
927211055 2:20639131-20639153 GAGTCTGGGCACCTGGACTGTGG + Intronic
927522466 2:23707673-23707695 CAAGCTGAGGACCAGGCCAGTGG + Exonic
927891558 2:26753542-26753564 CAGTTTGAAGACCTCCACAGAGG - Intergenic
930066601 2:47332521-47332543 CAGTCTCAGCACCTGGCTAGGGG + Intergenic
931174103 2:59835528-59835550 AAGCCTTAGGACCTGGCCAGGGG + Intergenic
931431722 2:62213965-62213987 CAGTGTGAAGACCTTGACTGCGG + Intronic
932489969 2:72114279-72114301 CACCATGAGGACCTGGAGAGAGG - Intergenic
933703648 2:85273935-85273957 CAGTCTGAGCTCCTGGTCAGAGG + Intronic
933985461 2:87588172-87588194 CAGCCTAAGGAGCTGGACAGTGG - Intergenic
936308380 2:111362629-111362651 CAGCCTAAGGAGCTGGACAGTGG + Intergenic
938061521 2:128258658-128258680 CACTCCTAGGACATGGACAGAGG - Intronic
942812289 2:180013501-180013523 CAGTAAGAGGACCAGGAAAGCGG - Intergenic
943291633 2:186079450-186079472 CAATATGAGAACCTGGAAAGAGG + Intergenic
945449477 2:209977143-209977165 AAGTGTGGTGACCTGGACAGAGG - Intronic
945837438 2:214849640-214849662 AAGTCTCAGAACCTGGATAGTGG - Intergenic
945857896 2:215090354-215090376 CAGAGTGAGGACAAGGACAGGGG - Intronic
946261339 2:218493809-218493831 AGGTCTGGGGAGCTGGACAGTGG - Intronic
947793332 2:232879823-232879845 CAGTCTGAGCATCTCGGCAGAGG - Intronic
948050324 2:234975038-234975060 GAGTTTCAGGAACTGGACAGGGG + Intronic
948785907 2:240352869-240352891 TAGTCAAAGGACCAGGACAGAGG + Intergenic
1169330236 20:4710463-4710485 CAGTCTGTGAGTCTGGACAGTGG - Intergenic
1169569065 20:6887122-6887144 CAGGCTGATGTCCTGGAGAGAGG + Intergenic
1170285238 20:14700907-14700929 CACTCTGAGGTCCAAGACAGTGG - Intronic
1170709693 20:18779185-18779207 CTGTATGAGGACATGGAAAGAGG + Intergenic
1170899217 20:20444172-20444194 CATTCTGTGGCCCTGTACAGAGG - Intronic
1171535335 20:25882537-25882559 CAATCTGGGGACATGGTCAGGGG - Intergenic
1173551164 20:43934037-43934059 CAGCCTGAGGACCAGAACAAAGG - Intronic
1175588767 20:60170058-60170080 CTGACTCAGGACCTGGCCAGAGG + Intergenic
1175859310 20:62141946-62141968 CACTGTGAGCACCTGGGCAGGGG + Intronic
1176064303 20:63186861-63186883 CAGCCTGAGGACCTGTGGAGGGG + Intergenic
1179430818 21:41319855-41319877 CATTCTGAGGTACTGGGCAGGGG - Intronic
1179728894 21:43356334-43356356 CAGTCTGTGCACCCTGACAGCGG + Intergenic
1179809564 21:43861830-43861852 CAATCTGAGCACCTGCACACTGG + Intergenic
1180076283 21:45464821-45464843 CAGGCTGTGGACCTGGAGATGGG - Intronic
1180181863 21:46121664-46121686 CTGCCTGAGGAGCAGGACAGGGG + Intronic
1181381919 22:22512057-22512079 CAGAATGAGGACCAGGACTGGGG + Intergenic
1181440407 22:22932628-22932650 CAGTCTGAGGTCCTGCCCACTGG - Intergenic
1181523040 22:23460232-23460254 CAGTCTGAGGACCTGGACAGGGG - Intergenic
1181591841 22:23890075-23890097 CAGCCTGAGGACAAGGACTGAGG - Intronic
1181787966 22:25241301-25241323 GAGTCTCAGGACCTTGACATGGG + Intergenic
1181819708 22:25466320-25466342 GAGTCTCAGGACCTTGACATGGG + Intergenic
1183469888 22:37999589-37999611 CAGCCTGAGGCCCTGGGGAGGGG - Intronic
1183533857 22:38383261-38383283 CAGGCTGACCACCTGCACAGTGG - Intronic
1183723843 22:39577723-39577745 CCGGCTGAGGGCCTGGAGAGGGG + Intronic
950040429 3:9916235-9916257 CACTCTGAGGCTCTGGCCAGAGG + Exonic
950675920 3:14554412-14554434 CGGTCTGTGGACCTGAACAGAGG + Intergenic
950693878 3:14682964-14682986 CAGTGTGGGGACCTGCACAAAGG - Exonic
951085058 3:18502601-18502623 CAGACTTATGAACTGGACAGGGG - Intergenic
952713205 3:36452971-36452993 CGGTCTGATCACCTGGATAGGGG - Intronic
952825160 3:37518574-37518596 AAGTCTGAGGTCCTGGATAAAGG - Intronic
952866879 3:37861029-37861051 GAGTCTGCGGACCGGGCCAGAGG - Intergenic
954411015 3:50371111-50371133 AAGTCTGAGGAGCTGGAAGGAGG + Intronic
955856308 3:63277688-63277710 CAGAGAGAGGACCAGGACAGAGG - Intronic
956494503 3:69810121-69810143 CAGTATGAGGCTCAGGACAGAGG - Intronic
961040286 3:123673594-123673616 TCTTCTGAGGACCTGGACTGGGG - Intronic
961168897 3:124781827-124781849 AAGTCTGAGGAGTTGCACAGTGG - Intronic
961771867 3:129255945-129255967 GTCTCTGAGGACCAGGACAGTGG + Intronic
962276993 3:134022869-134022891 AACTGTGGGGACCTGGACAGTGG - Intronic
962292799 3:134150769-134150791 CGTTCTGAGGACTGGGACAGGGG + Intronic
962732051 3:138292588-138292610 TAGCCTGAGCAACTGGACAGAGG + Intronic
963116137 3:141730799-141730821 CAGGCTCAGTACCTGGAAAGCGG - Intergenic
963870584 3:150409978-150410000 CAGACTGCGGAGCGGGACAGCGG + Exonic
965423327 3:168489994-168490016 CAGTCTTAGGACCAGTAGAGGGG + Intergenic
966085153 3:176061837-176061859 CGGTCTGAGGACCTGAACGTAGG - Intergenic
966910207 3:184555437-184555459 CAGACCTAGGACCTGGGCAGAGG + Intronic
967497069 3:190153901-190153923 GTGTCTGAGGACCTTGACAAGGG - Intergenic
967661964 3:192123220-192123242 CAGTCTGAAGCCCTGGCAAGGGG + Intergenic
968455408 4:695965-695987 GACTCTGAGGACCTGGACCGTGG + Intergenic
970657901 4:18251794-18251816 CAGTGGGAGCACCTTGACAGCGG + Intergenic
970861141 4:20703902-20703924 CAGTCTGAGGACCAGAAAACTGG + Intronic
975215201 4:71745290-71745312 CAGTCTGAGAACCAGTACAAGGG - Intronic
978303461 4:107295404-107295426 CAGAGTGAGGACAAGGACAGAGG + Intergenic
979798552 4:124877155-124877177 CAGACTGAGGGCAAGGACAGGGG + Intergenic
981948529 4:150377882-150377904 GAGGCTGAGGACCTGGGAAGGGG + Intronic
984129542 4:175856690-175856712 CAGGATGGGGACCTGGAAAGGGG + Intronic
984737958 4:183128755-183128777 CAGTTGGAGGACAAGGACAGAGG - Intronic
985732184 5:1555574-1555596 CACTCAGAGGAGCTGGACACGGG - Intergenic
985764129 5:1768028-1768050 CAGTCTGGGGCCCTGGGCTGAGG + Intergenic
986767940 5:10944799-10944821 CAATCTGGGGACTTGCACAGTGG - Intergenic
986884405 5:12215989-12216011 CAGTCTGAGCACCTGTCCATGGG - Intergenic
992397650 5:76382354-76382376 GAGTCGGAGGACCTGAGCAGTGG - Intergenic
993661667 5:90645191-90645213 CAGTCTCAGCACCGGGACACGGG + Intronic
994964761 5:106654420-106654442 GAGTCAGAGGACCTGGACCATGG + Intergenic
997359201 5:133283682-133283704 CATTATGAGGAATTGGACAGTGG + Intronic
998423125 5:142005518-142005540 CACCCAGAGAACCTGGACAGGGG + Intronic
999729226 5:154463241-154463263 CATTCTGAGGATCTGGAATGGGG - Intergenic
1000998220 5:167980465-167980487 CAGTGTGACCACCTGGACATGGG + Intronic
1001000025 5:167996765-167996787 CAGCCTGGGCACCTGGACAATGG - Intronic
1001042892 5:168349464-168349486 CAGGATGAGGCCCTGGAGAGTGG - Intronic
1001308244 5:170591321-170591343 TATTCTCAGGACTTGGACAGCGG + Intronic
1001350184 5:170954878-170954900 CAGGCTGTGGACCAGTACAGGGG - Intronic
1001626490 5:173140142-173140164 CAGTCTCAAGATCTTGACAGAGG - Intergenic
1001705874 5:173740906-173740928 TGGCCTGAGGAACTGGACAGAGG - Intergenic
1004860633 6:19801384-19801406 CAGTCTGAGGCCCAGGACTTGGG - Intergenic
1005974794 6:30789856-30789878 GAGTCTGGGGACCTTGCCAGAGG - Intergenic
1006220302 6:32484241-32484263 CACTTTGAGGACCCGGCCAGCGG + Intergenic
1006383983 6:33718649-33718671 CCGTATGAGGACATGGGCAGAGG + Intergenic
1006583999 6:35093740-35093762 CAGCCAGAGGACCAGGAAAGGGG + Intergenic
1007228629 6:40332249-40332271 CAGTCTGAGATCCAGGACAATGG - Intergenic
1008048557 6:46876216-46876238 CAGCCTGGGGACCTGCACCGTGG - Intronic
1010373549 6:75139816-75139838 CAGCCAGAGGACCTGGTCAATGG - Intronic
1010437745 6:75854434-75854456 CTGTTGGAGGAACTGGACAGGGG + Intronic
1012826604 6:104153845-104153867 CTGTTTGAGGCCTTGGACAGAGG + Intergenic
1013480017 6:110545020-110545042 CAGTCTGAGGTCCTGAGCAGTGG - Intergenic
1018058465 6:160071629-160071651 CAGGCTGAGGAACAGGACAGGGG - Intronic
1018151006 6:160939810-160939832 CAGTCTGAGGACATGGCAGGGGG - Intergenic
1018541515 6:164885059-164885081 CAGTGAGAGGACCTGCAGAGAGG + Intergenic
1018828978 6:167427718-167427740 CAGTGTGCTGACATGGACAGTGG - Intergenic
1019588292 7:1816331-1816353 CAGTCTGAGGACCTGGACAGGGG + Intronic
1020372098 7:7443532-7443554 CAGTATGAGGACCAGAACACAGG + Intronic
1021838874 7:24706357-24706379 CAGTGCGATGACCTGGTCAGCGG - Exonic
1024171023 7:46786723-46786745 CAGGCTGAGGCCCTGGAGACTGG - Intergenic
1024207134 7:47173395-47173417 CAGTCTCAGAAGCTGGACACAGG - Intergenic
1024275487 7:47673727-47673749 CAGTCTTAGGGCCTGGTCTGAGG + Intergenic
1026470303 7:70689425-70689447 CAGGGTCAGAACCTGGACAGTGG - Intronic
1026928040 7:74207335-74207357 CAGACTGTGCACCTGGATAGAGG - Intronic
1027810379 7:82889046-82889068 CAGTCTGAGGAACTATTCAGCGG + Intronic
1028163887 7:87515882-87515904 CAGTCTGAGGTCAAGCACAGTGG - Intronic
1032167561 7:129557497-129557519 CAGTCTCCGGACCTGCACAATGG + Intergenic
1033678605 7:143569804-143569826 CATGCTGAGGACCTGGTGAGAGG - Intergenic
1033693237 7:143759646-143759668 CATGCTGAGGACCTGGTGAGAGG + Intergenic
1034274336 7:149817503-149817525 CAGTGTGAGGACCCGGAAAAGGG - Intergenic
1034563383 7:151895493-151895515 CAGTGTCAGAACATGGACAGAGG - Intergenic
1034696856 7:153061379-153061401 AAGCCTGAGGTCCTGGAGAGAGG - Intergenic
1034727914 7:153357432-153357454 CACTGTGAGGTCCTGGACATTGG + Intergenic
1035261660 7:157665466-157665488 CACTCTGAGGAGCTGGACGGAGG + Intronic
1035626501 8:1075107-1075129 GAGTCTGAGGACATCGCCAGAGG - Intergenic
1036089273 8:5647700-5647722 AGGTCTGATGACCTGGGCAGAGG - Intergenic
1036644146 8:10601570-10601592 CAGGCTGAGGACGAGGACAGAGG + Intergenic
1036990245 8:13584321-13584343 CTGCCTGTGGGCCTGGACAGGGG + Intergenic
1037422669 8:18720473-18720495 TAGTCTGAGGATATGGATAGAGG - Intronic
1038700593 8:29846176-29846198 CACTCTAAGAACCTGGATAGTGG + Intergenic
1038990178 8:32859424-32859446 CAGTGGGAGGACATGGACCGTGG + Intergenic
1040484319 8:47855664-47855686 TTATCTGAGGCCCTGGACAGGGG + Intronic
1045346695 8:101300072-101300094 CAGTCTGAGGATCTAGACCAAGG - Intergenic
1046124007 8:109881713-109881735 CAGTTTGAGGACCCCCACAGAGG - Intergenic
1047940966 8:129827022-129827044 CACTTTGAGAACCAGGACAGAGG - Intergenic
1048293980 8:133200793-133200815 CAGTCAGGGGCCCGGGACAGAGG - Intronic
1048324641 8:133429557-133429579 CAGCCTGAGGACCAGAGCAGTGG - Intergenic
1049212687 8:141393999-141394021 CTGGCTGAGGACTTGGGCAGAGG + Intronic
1049588537 8:143442983-143443005 CTTTCTGAGGCCCTGCACAGTGG + Intronic
1050683837 9:8145191-8145213 TAGTCTGAGGTACTGGAGAGAGG - Intergenic
1052827245 9:33186166-33186188 CAGGCTGGGGACCTGGGGAGTGG - Intergenic
1055514661 9:77022936-77022958 AAGTCTGCGGTCCTGGACGGAGG + Intergenic
1057050055 9:91916685-91916707 CAGTGTCAGGACCTGGAAAAGGG - Intronic
1057210904 9:93200528-93200550 CAGGCTGAGGAACTGGGCAATGG - Intronic
1057711875 9:97452964-97452986 CAGTCTGGGGACTGGGAGAGGGG + Intronic
1058882479 9:109297595-109297617 GAGTCAGAGGTCCTGGGCAGAGG - Intronic
1060206475 9:121685400-121685422 TAGTCTGAGGCCTGGGACAGAGG + Intronic
1060405396 9:123370558-123370580 CAGTCTCAGGACAAGCACAGTGG - Exonic
1060602428 9:124887067-124887089 CAGTCTGAGGAAAGGGAGAGAGG + Intronic
1060831452 9:126720202-126720224 GATCCTGAGGACCTGGCCAGAGG - Intergenic
1062117118 9:134815458-134815480 AAGTCTTAGGAGCTGGACGGTGG + Intronic
1062380106 9:136282961-136282983 CAGTCTGAGGCCGGGCACAGTGG + Intronic
1062448658 9:136606431-136606453 CAGTGTGAGGGCCTGGATATGGG - Intergenic
1062546639 9:137066537-137066559 CAGTGTGAGGAGCTGGAAAGGGG - Intronic
1062686108 9:137814213-137814235 CTGGCTGAGGACCCTGACAGAGG - Intronic
1186043261 X:5504801-5504823 CGGTCTTAGGACTTGGAGAGAGG - Intergenic
1189295983 X:39918194-39918216 CAGGCTGAGGTCCTGGCCAGAGG - Intergenic
1190333685 X:49250351-49250373 CAGCAGGAGGAACTGGACAGCGG - Exonic
1190462921 X:50696562-50696584 GACTCTGAAGACCTGGAAAGTGG + Intronic
1190576342 X:51843182-51843204 CAATCTGGGAACCTGGAAAGGGG - Intronic
1191828665 X:65392404-65392426 CAGACTGGGCAGCTGGACAGAGG - Intronic
1193516987 X:82478265-82478287 CAGCCTGAGGATCTGGAGGGAGG - Intergenic
1194412870 X:93578130-93578152 CACTTTGGGGACCTGGTCAGTGG + Intergenic
1199945758 X:152665754-152665776 CAGCCAAAGGACCAGGACAGGGG + Intergenic
1200777130 Y:7179508-7179530 CAGTCTGAGGAGCTTTACAGAGG + Intergenic
1202593588 Y:26512746-26512768 CAGGCTGACCACCTGCACAGTGG + Intergenic