ID: 1019588468

View in Genome Browser
Species Human (GRCh38)
Location 7:1817035-1817057
Sequence TCAAGGGCCCCTTGTTTAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 89
Summary {0: 1, 1: 1, 2: 1, 3: 5, 4: 81}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019588468_1019588474 25 Left 1019588468 7:1817035-1817057 CCAATTAAACAAGGGGCCCTTGA 0: 1
1: 1
2: 1
3: 5
4: 81
Right 1019588474 7:1817083-1817105 ACGGCCAATGAGCTCATGCCAGG 0: 1
1: 1
2: 0
3: 6
4: 64
1019588468_1019588471 6 Left 1019588468 7:1817035-1817057 CCAATTAAACAAGGGGCCCTTGA 0: 1
1: 1
2: 1
3: 5
4: 81
Right 1019588471 7:1817064-1817086 CTCCAGAGAAGAGCCACACACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019588468 Original CRISPR TCAAGGGCCCCTTGTTTAAT TGG (reversed) Intronic
904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG + Intronic
909592366 1:77365186-77365208 TCAATGGCTCATTTTTTAATTGG + Intronic
910275979 1:85449496-85449518 TAAAGTGTCCCTTGTTCAATAGG - Intronic
912111247 1:106345573-106345595 TCTAGGTCCCCCTGTTTCATGGG - Intergenic
912435262 1:109656966-109656988 TGCTGGGCCCCCTGTTTAATTGG + Intronic
919027165 1:192188247-192188269 TCAAAGGACCCTTCTATAATTGG - Intergenic
922064009 1:222118307-222118329 TCCAAGGCCCCTAGTTTAAGAGG - Intergenic
923824539 1:237485410-237485432 TCAAGGGCTCGTTCTGTAATGGG + Intronic
1065542375 10:26783304-26783326 TCAAAGGACACTTGTTTAATGGG + Intronic
1065758522 10:28958867-28958889 TTAAGGGGACCTTGGTTAATGGG + Intergenic
1071309649 10:84330348-84330370 TCAAGGGCAAGTTGTTTACTAGG - Intronic
1073649854 10:105346824-105346846 TCAAGTGCCCTTTGCCTAATAGG + Intergenic
1077658467 11:4045128-4045150 TCAAGGGCCTTTTGTCTACTGGG - Intronic
1078051440 11:7968245-7968267 TCAAAGGGCCCTTGTATAAGAGG - Intergenic
1082180106 11:49106721-49106743 TTGAGGACCCCTTGTTGAATAGG - Intergenic
1086664924 11:89468578-89468600 TAAAGGGATCATTGTTTAATAGG - Intronic
1086685385 11:89728144-89728166 TTGAGGACCCCTTGTTGAATAGG + Intergenic
1087486542 11:98764489-98764511 TCTAGGCCCCCATGTTTGATGGG + Intergenic
1089489142 11:118870844-118870866 TCCAGAGCACCTTGCTTAATCGG + Intergenic
1091717443 12:2789264-2789286 TTAAGGGGCCCTTGTTTGCTAGG - Intergenic
1100080964 12:90849490-90849512 TCAAGGGGACCTTGATTAAGGGG + Intergenic
1100171586 12:91981099-91981121 TCATTTGCCCATTGTTTAATGGG + Intergenic
1100841448 12:98616316-98616338 TCCATAGCCCATTGTTTAATTGG + Intronic
1102817098 12:115875391-115875413 TCAATGGCAACTTGTGTAATTGG - Intergenic
1104070353 12:125339412-125339434 TCAAGAGCCCCCAGTTCAATTGG - Intronic
1113658080 13:112082594-112082616 TCAAGTGCCCCTTCTTTCAAAGG + Intergenic
1116176626 14:41479102-41479124 TCAAGGGCTCCTTTTATAAAGGG - Intergenic
1119082414 14:71708066-71708088 TCATTTGCCCATTGTTTAATTGG + Intronic
1124943609 15:34242204-34242226 TCTAGGGCCCTTTCTTTCATGGG - Exonic
1129023135 15:72541930-72541952 TCAAGGGAACCTTATCTAATGGG + Intronic
1129189608 15:73929711-73929733 TCTAGGGCCCCTTGGAGAATAGG + Intronic
1141495813 16:84408660-84408682 TCAAGGTGCCCTGGTTTATTCGG + Intronic
1142801075 17:2346266-2346288 TCAAGGGACCCTTGTGTACTGGG + Intronic
1143883755 17:10050831-10050853 TCCAGGCCCCCTTGTTTGAATGG - Intronic
1144418105 17:15070733-15070755 TCAAAGGTCACTTGTGTAATAGG + Intergenic
1146547625 17:33752531-33752553 TCATTGGCCCATTTTTTAATTGG - Intronic
1148203724 17:45766369-45766391 TCAAGGGCAGGTTGTTTATTTGG - Intergenic
1151103566 17:71585056-71585078 TCAATGGTCCATTGCTTAATAGG + Intergenic
1153267497 18:3285562-3285584 TCAAGAGCCACTTGCTTACTTGG - Intergenic
1156643453 18:39130365-39130387 TCCAGGGCCCCTTGTGGAAATGG - Intergenic
1161339639 19:3734224-3734246 TCTAGGGCCCTTTGTTTAGAGGG + Intronic
1165939761 19:39409171-39409193 TAAAGGGCCCATTGATTTATGGG - Exonic
931917233 2:66969465-66969487 TCCAGGGCCCCTTGTGCATTTGG + Intergenic
932118521 2:69076924-69076946 GCAAGGGCCCTTTCCTTAATGGG + Intronic
937161426 2:119766080-119766102 GCAAGATACCCTTGTTTAATGGG + Intronic
937602327 2:123753672-123753694 TCACCAGCCCTTTGTTTAATAGG - Intergenic
939094703 2:137821382-137821404 TCAAGAGCCCCCTGATTACTAGG + Intergenic
939679156 2:145109009-145109031 TCAAGGGCCCCGGGTTTCAGTGG + Intergenic
944312807 2:198253500-198253522 TCAACAGCCCCTTATTTATTAGG - Intronic
1172082224 20:32351080-32351102 CCGAGGGCCCCTGGTCTAATGGG - Intergenic
1172957884 20:38774459-38774481 TCATTAGCCCCTTTTTTAATTGG + Intergenic
1180914161 22:19473758-19473780 TCAATGTCCTCTTCTTTAATTGG - Intronic
1181522856 22:23459502-23459524 TCAAAGGCCCCTTGTTTAATCGG + Intergenic
957793156 3:84964629-84964651 TCAAAAGCCCTTTGTTGAATTGG + Intronic
959100381 3:102002885-102002907 TCAAGGCCCCCTTGAATAAAGGG - Intergenic
961719621 3:128884355-128884377 TCTTGGGCTCCTTGTTTCATGGG + Intronic
966908904 3:184547068-184547090 TCATGGGCCCCTGGCTTAGTTGG + Intronic
968932238 4:3587259-3587281 CCAAGGGCCCCTTGTTTCTGAGG - Intronic
978187918 4:105880043-105880065 TTAAGGGCCCCTTGTTTAAAAGG - Intronic
982491376 4:156033662-156033684 TCATGGGCTCGTTTTTTAATTGG + Intergenic
983368649 4:166830161-166830183 TTAAGGCAACCTTGTTTAATGGG - Intronic
984222366 4:176993931-176993953 TCATGGGCCCCCTGTTAAACTGG - Intergenic
992090143 5:73309856-73309878 TGCAGGGCCCCTTGTTAAAAAGG + Intergenic
995548626 5:113257527-113257549 ACAAAGACCCCTTATTTAATAGG - Intronic
996345484 5:122483943-122483965 TCTAGGGCCCCTTGTTAAAAAGG - Intergenic
1001036415 5:168299937-168299959 TCCAGGGCCCCTTGCTGAACTGG - Intronic
1019106269 6:169669844-169669866 TCATGGGCCTCATGTGTAATAGG - Intronic
1019588468 7:1817035-1817057 TCAAGGGCCCCTTGTTTAATTGG - Intronic
1022229820 7:28403759-28403781 TGCAGGGCCTCTTGTTTAAAAGG + Intronic
1026102618 7:67395508-67395530 TCAAGAGCTGCTTGTTTAAAGGG - Intergenic
1026135384 7:67656265-67656287 TCAAGAGCTGATTGTTTAATAGG - Intergenic
1028530125 7:91829479-91829501 TCAAGGGCTTATTGTTTAATTGG - Intronic
1032682991 7:134204527-134204549 TCAAGGCCCCTTTGTTTTTTTGG + Intronic
1035876216 8:3192527-3192549 TAAAGGGCAACTTGTTTTATGGG - Intronic
1037704602 8:21308738-21308760 TCAAGGGGGCCTGGTTTAAGTGG + Intergenic
1039631409 8:39115566-39115588 TCATTGGCCCATTTTTTAATGGG + Intronic
1040952075 8:52947513-52947535 TCATTTGCCCATTGTTTAATGGG + Intergenic
1047217614 8:122889550-122889572 TCAACTGCCCATTTTTTAATTGG + Intronic
1048085468 8:131173368-131173390 TCAAGAACCCATTGTTTACTAGG + Intergenic
1048876018 8:138837592-138837614 TCAAAGGCCCCTTGTTGTATGGG - Intronic
1050792898 9:9496067-9496089 GCAAGGGCACCCTGTTTACTTGG - Intronic
1054457895 9:65444669-65444691 CCAAGGGCCCCTTGTTTCTGAGG + Intergenic
1059739524 9:117136010-117136032 TGAAGGGCATATTGTTTAATGGG - Intronic
1061324604 9:129855915-129855937 TCATGGCGCCCTTGTCTAATGGG + Intronic
1187445346 X:19356055-19356077 TCAAGGGACTCATGATTAATGGG - Intronic
1194279284 X:91927921-91927943 TCAGGGCCCCATTGTTTACTAGG + Intronic
1198971060 X:142280757-142280779 TCAAGACCTCCTAGTTTAATGGG + Intergenic
1199976186 X:152896175-152896197 TCAAGAGCCCCTAGTTTGAAAGG - Intergenic
1200596760 Y:5151416-5151438 TCAGGGCCCCATTGTTTACTAGG + Intronic