ID: 1019594146

View in Genome Browser
Species Human (GRCh38)
Location 7:1850635-1850657
Sequence ACCATGGCTTTGGGGGTCCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 245}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019594146_1019594157 3 Left 1019594146 7:1850635-1850657 CCGGGGACCCCCAAAGCCATGGT 0: 1
1: 0
2: 0
3: 15
4: 245
Right 1019594157 7:1850661-1850683 CCAAGTTCGCAGAGGGGAACAGG 0: 1
1: 0
2: 0
3: 7
4: 101
1019594146_1019594159 13 Left 1019594146 7:1850635-1850657 CCGGGGACCCCCAAAGCCATGGT 0: 1
1: 0
2: 0
3: 15
4: 245
Right 1019594159 7:1850671-1850693 AGAGGGGAACAGGCACCCCAGGG No data
1019594146_1019594160 19 Left 1019594146 7:1850635-1850657 CCGGGGACCCCCAAAGCCATGGT 0: 1
1: 0
2: 0
3: 15
4: 245
Right 1019594160 7:1850677-1850699 GAACAGGCACCCCAGGGCACAGG 0: 1
1: 0
2: 2
3: 23
4: 286
1019594146_1019594154 -3 Left 1019594146 7:1850635-1850657 CCGGGGACCCCCAAAGCCATGGT 0: 1
1: 0
2: 0
3: 15
4: 245
Right 1019594154 7:1850655-1850677 GGTTGCCCAAGTTCGCAGAGGGG 0: 1
1: 0
2: 0
3: 4
4: 80
1019594146_1019594158 12 Left 1019594146 7:1850635-1850657 CCGGGGACCCCCAAAGCCATGGT 0: 1
1: 0
2: 0
3: 15
4: 245
Right 1019594158 7:1850670-1850692 CAGAGGGGAACAGGCACCCCAGG 0: 1
1: 0
2: 2
3: 62
4: 366
1019594146_1019594161 20 Left 1019594146 7:1850635-1850657 CCGGGGACCCCCAAAGCCATGGT 0: 1
1: 0
2: 0
3: 15
4: 245
Right 1019594161 7:1850678-1850700 AACAGGCACCCCAGGGCACAGGG 0: 1
1: 0
2: 3
3: 26
4: 288
1019594146_1019594152 -5 Left 1019594146 7:1850635-1850657 CCGGGGACCCCCAAAGCCATGGT 0: 1
1: 0
2: 0
3: 15
4: 245
Right 1019594152 7:1850653-1850675 ATGGTTGCCCAAGTTCGCAGAGG 0: 1
1: 0
2: 1
3: 4
4: 65
1019594146_1019594153 -4 Left 1019594146 7:1850635-1850657 CCGGGGACCCCCAAAGCCATGGT 0: 1
1: 0
2: 0
3: 15
4: 245
Right 1019594153 7:1850654-1850676 TGGTTGCCCAAGTTCGCAGAGGG 0: 1
1: 0
2: 0
3: 8
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019594146 Original CRISPR ACCATGGCTTTGGGGGTCCC CGG (reversed) Intronic
900205170 1:1428300-1428322 TCCAGGGCTCTGGGGCTCCCAGG + Intergenic
900323258 1:2095307-2095329 ACCATGGTTTTGGAGGTGGCTGG + Intronic
900413472 1:2524347-2524369 ACTTTGGCTTTGAGGGTTCCTGG + Intronic
900763189 1:4486638-4486660 ACCTTGGCTTTGGCCGTGCCTGG + Intergenic
900933777 1:5752789-5752811 ACCCTGGTTTCTGGGGTCCCGGG - Intergenic
901102382 1:6728744-6728766 AGCATGGCCTTGGGGATGCCTGG + Intergenic
901658011 1:10781627-10781649 AGCCTGGCCTTGGGGGTCTCTGG + Intronic
903272107 1:22196074-22196096 CCCTTGGCCTTGGGGCTCCCAGG + Intergenic
905859854 1:41342881-41342903 AGCCTGGCTTTGGAGGGCCCTGG + Intergenic
906557041 1:46722128-46722150 TCCCTGGCCTTGAGGGTCCCGGG - Intergenic
907412296 1:54291328-54291350 TCCCTGGCATTGGGGGACCCGGG - Intronic
907972988 1:59402934-59402956 AGCCTGGGTATGGGGGTCCCGGG + Intronic
911285826 1:95991139-95991161 CCCAACGCTTTGGGGGTCCTAGG + Intergenic
916563610 1:165954414-165954436 TCCATGGCCTTTGGGGTCCTGGG + Intergenic
917215192 1:172671052-172671074 ACCATGGCTTTGGGAGAGGCAGG - Intergenic
919605557 1:199678350-199678372 AGCATGGCTGTGGGGGCCTCAGG - Intergenic
920079076 1:203359212-203359234 ACCTTGGCTGTAGGGTTCCCTGG + Intergenic
922749856 1:228065220-228065242 ACCTTGGCTCAGGGGGTCCTCGG + Intergenic
923370676 1:233309289-233309311 CCCATGGCTTTGGGAGGCCAAGG + Intergenic
923652237 1:235884483-235884505 ACCATGGCTTTGGGAGACTGGGG - Intergenic
924584549 1:245350586-245350608 ACCTGGGCTTTGATGGTCCCAGG - Intronic
1063666347 10:8062864-8062886 TCCTTGGTTTTGGGGGACCCAGG - Intronic
1064045518 10:12011238-12011260 ACCAGGGCTTTGGGAGGCCAAGG - Intronic
1064181349 10:13118716-13118738 AGCTTGGCACTGGGGGTCCCAGG + Intronic
1064369754 10:14741092-14741114 CCCATGGCTTTGGGAGTCAGAGG + Intronic
1064905436 10:20340653-20340675 CCCATGACTTTGGGAGGCCCAGG + Intergenic
1064981311 10:21170282-21170304 ACAATGCCTTTGGGTGGCCCTGG - Intronic
1065844391 10:29733553-29733575 ACCAAGGCTTTGGGAGGCCGAGG - Intronic
1068035159 10:51750184-51750206 ACCAGCACTTTGGGGGTCCGAGG - Intronic
1068041495 10:51830810-51830832 ACCAGCACTTTGGGGGGCCCAGG - Intronic
1069199602 10:65596312-65596334 CCCAGCGCTTTGGGAGTCCCAGG - Intergenic
1069240173 10:66129368-66129390 ACCATGGCATTGGAGTTGCCAGG + Intronic
1069604593 10:69731525-69731547 CCACTGGCTCTGGGGGTCCCTGG - Intergenic
1070669141 10:78365824-78365846 ACCATGGCTGTTGGGATGCCAGG - Intergenic
1071662099 10:87514964-87514986 ACCAGCACTTTGGGGGGCCCAGG - Intronic
1074535328 10:114324868-114324890 AAAATGGATTTGGGGGACCCAGG + Intronic
1076731526 10:132441353-132441375 CCCATGCCTTTGGGGGTGTCGGG + Intergenic
1077363407 11:2151258-2151280 ACCATGGCTTAGCTGCTCCCCGG - Intronic
1078872584 11:15362873-15362895 ACCAAGTCTTTGGGGATGCCTGG - Intergenic
1082884496 11:58068375-58068397 ACCATGGCATTGGGTTTCCCGGG - Intronic
1083620979 11:64049291-64049313 CCCAAGGCTTTGGGGATCCTGGG - Intronic
1083723908 11:64618636-64618658 TCCATTGCTTTGGGGGGCTCTGG - Intronic
1083969910 11:66068607-66068629 ACCCTTGTTTTGGGGGTCCGGGG + Intronic
1084669633 11:70597396-70597418 ACCATGGATTTGGGGCTCACAGG + Intronic
1084947519 11:72646543-72646565 GCCCTGGCTTTGGGGGGTCCTGG - Intronic
1085303012 11:75469303-75469325 ACCATGGCATTGGGGGTGGGTGG + Intronic
1085614131 11:77982055-77982077 ACCACTGCTTTTGGAGTCCCTGG + Intronic
1086954737 11:92924439-92924461 ACCATGGCTGAGGAGGTCTCAGG - Intergenic
1087288574 11:96294865-96294887 AGCATGGGATTGGGGGACCCAGG + Intronic
1089613686 11:119683552-119683574 ACAGGGGCTTTGGGGATCCCGGG + Intronic
1090365893 11:126205315-126205337 ACCATCTCTCTGGGAGTCCCCGG + Intronic
1091744374 12:2981912-2981934 ACCCTGATTTTGGGGGTCACTGG - Intronic
1091759158 12:3076230-3076252 CCCAGGACTTTGGGGGGCCCAGG - Intergenic
1096241603 12:49962758-49962780 ATCACGGCTTTGGGTGACCCTGG + Intronic
1097070276 12:56349509-56349531 ACTATGTCTTTGGCTGTCCCAGG - Exonic
1097197787 12:57253537-57253559 ACCATGGCTTTGGGCTCTCCCGG - Intronic
1100933000 12:99632143-99632165 GCCATGGCTTAAGTGGTCCCAGG + Intronic
1102149319 12:110677845-110677867 AGCATGGCTTTAGGGGAACCTGG - Intronic
1102259849 12:111437222-111437244 CTGAGGGCTTTGGGGGTCCCAGG - Intronic
1102723362 12:115036765-115036787 ACCATGGCTGGGGAGGTCTCAGG + Intergenic
1102933971 12:116881668-116881690 TCCTGGGCTTTGGGGGTCTCGGG + Intergenic
1103265041 12:119622664-119622686 TCCATGGCTGGGGGGGTCTCGGG - Intronic
1103298383 12:119907527-119907549 CCCAGTGCTTTGGGGGGCCCAGG + Intergenic
1104139501 12:125973826-125973848 CCCATGAGTTTGTGGGTCCCAGG + Intergenic
1105679725 13:22713893-22713915 ACCAGGGCTTTGGTGGGCACAGG + Intergenic
1106346911 13:28887882-28887904 ACCATGCCTTTGGGACTTCCAGG - Intronic
1107282328 13:38750942-38750964 AGCATGGCTTTGGGAGGCCAAGG - Intronic
1108582312 13:51837958-51837980 TCCCAGGCCTTGGGGGTCCCTGG - Intergenic
1108760206 13:53553498-53553520 AGCATGGCTTGGGGGGCCTCAGG - Intergenic
1110620066 13:77585290-77585312 AGCATGGCTTTGGGTATCACTGG + Intronic
1110916329 13:81025955-81025977 ACAATGGCTTTGGGGGAAGCAGG - Intergenic
1111182520 13:84687393-84687415 TCCAGGGCTTTGGGAGTCACAGG - Intergenic
1112141537 13:96649216-96649238 ACCATGGCTTAGGAGGTCTCAGG + Intronic
1112386755 13:98946827-98946849 TCCATGGCTAGGGAGGTCCCAGG - Intronic
1112876941 13:104053579-104053601 CCCATGGCTTTGGAGGCCTCAGG - Intergenic
1113808719 13:113124433-113124455 ACCATGGCCTGTGGTGTCCCCGG + Intronic
1113906835 13:113823253-113823275 TCAGAGGCTTTGGGGGTCCCTGG + Intronic
1114265972 14:21072801-21072823 ACCTTGGCTTTGGAGATCCAGGG - Intronic
1115168056 14:30471875-30471897 CCCATAGCCTTAGGGGTCCCAGG + Intergenic
1118311024 14:64693099-64693121 ACCATGGTTTTGGGGCCACCTGG + Intergenic
1118810771 14:69271460-69271482 AGCTTGGCTTCGGGGATCCCAGG - Intronic
1121649749 14:95549249-95549271 CCCAGGGCTTTGGGAGGCCCAGG - Intergenic
1122831077 14:104396203-104396225 ACCCTGGGTGTGGGCGTCCCGGG + Intergenic
1122861590 14:104585002-104585024 CCCATCCCTTTGGGGGACCCTGG + Intronic
1122893252 14:104742695-104742717 AGCTTGGCTTTGGGGGTCAGGGG - Intronic
1123038887 14:105482434-105482456 ACCAGGGCCTTGTGGATCCCTGG - Intergenic
1125926374 15:43566593-43566615 ACCATGGTTTCAGGGGTCCCAGG + Intronic
1125939518 15:43666143-43666165 ACCATGGTTTCAGGGGTCCCAGG + Intronic
1127782440 15:62329063-62329085 ACTATGGGTCTGGGGCTCCCTGG + Intergenic
1129996427 15:80010204-80010226 CCCAGCGCTTTGGGGGGCCCAGG - Intergenic
1130930786 15:88426031-88426053 TCCCTGGGTTTGGGGCTCCCAGG - Intergenic
1132594596 16:742659-742681 ACCAGCGCTTTGGGAGGCCCAGG + Intronic
1133212301 16:4270528-4270550 GGCATGGAGTTGGGGGTCCCTGG - Intronic
1134441260 16:14301146-14301168 GCAATGGATTTGGGGGTCCCTGG + Intergenic
1134905348 16:17975017-17975039 ACCATTCCTTTGTGGGTCTCTGG - Intergenic
1136378581 16:29879917-29879939 TCGATGGCATTGGGGGGCCCAGG + Exonic
1136610147 16:31361325-31361347 GACATGGCTATCGGGGTCCCGGG - Intronic
1137380637 16:47995715-47995737 AGGATGGCTTTGGGGATTCCAGG + Intergenic
1137569799 16:49557908-49557930 TCTCTGGCTTTGGGGGCCCCAGG - Intronic
1137590350 16:49689683-49689705 ACCATGCCTTTGGGGCCCCCGGG - Intronic
1138563330 16:57815266-57815288 CCCAAGGCTGTGGGGGTCCTGGG + Intronic
1139433153 16:66921937-66921959 ACCATGAGGTTGGGGGTGCCCGG + Exonic
1139599875 16:67980145-67980167 TCCAGGGTTTTGGGGGTGCCTGG + Exonic
1139975114 16:70803865-70803887 ACCATGGGAATGGGGCTCCCTGG - Intergenic
1140056095 16:71526947-71526969 ACCCAGGTTTTGGGGATCCCAGG - Intronic
1140583382 16:76257343-76257365 ACCATGGCTTTGTGGCCCTCAGG + Intergenic
1141678373 16:85529660-85529682 GCCCTGGCTTTAGGTGTCCCTGG + Intergenic
1142292683 16:89200158-89200180 ACCAAGGCCCTGGGTGTCCCCGG - Intronic
1142981327 17:3673787-3673809 CCCATGCCTTTGGGAATCCCAGG - Exonic
1144054504 17:11527147-11527169 ACCATGGGTTTGGGTTCCCCAGG + Intronic
1144726902 17:17506742-17506764 AAACTGGCTTTGGGGGACCCTGG - Intronic
1145167787 17:20629294-20629316 GCCATGGCTTTTGCTGTCCCAGG - Intergenic
1146728509 17:35174567-35174589 CCCAGGGCTTTGGGAGGCCCAGG + Intronic
1147200813 17:38799866-38799888 ACCCTGGCGTTGGGGGGCCCGGG - Exonic
1148908694 17:50928133-50928155 TCCATAGCTTTGGGGGAGCCTGG - Intergenic
1150511252 17:65755204-65755226 AGCATGGCTGGGGAGGTCCCAGG + Intronic
1152422547 17:80201960-80201982 CTCTTGGCTCTGGGGGTCCCTGG - Intronic
1153837762 18:8979348-8979370 CCCAGTGCTTTGGGAGTCCCAGG - Intergenic
1156403301 18:36759998-36760020 ACCAATTCTTTTGGGGTCCCTGG + Intronic
1156492326 18:37503524-37503546 ACCTTGGCTTGGAGTGTCCCTGG - Intronic
1159016132 18:63102920-63102942 ATCATGGCTCTGACGGTCCCAGG + Intergenic
1160185632 18:76674434-76674456 ACCATGGCTGGGGAGGTCTCAGG - Intergenic
1160510901 18:79452746-79452768 TCCCTGGTTTTGGGGGTTCCTGG + Intronic
1160816050 19:1036275-1036297 ACCACGGCATTGGGGGACCACGG + Intronic
1160873542 19:1287275-1287297 GCCGGGGCTTTGGGGGTCCTGGG + Intronic
1161053532 19:2178276-2178298 ACCATGTCTTTGGGAGGCCAAGG + Intronic
1161155735 19:2731239-2731261 AGCATTGCCATGGGGGTCCCAGG - Intronic
1161718759 19:5892033-5892055 GCCTCGGCTTTGGGGTTCCCTGG + Exonic
1161811969 19:6476396-6476418 ACCCTGGGTTTCAGGGTCCCTGG + Intronic
1161926528 19:7304681-7304703 CCCAGCGCTTTGGGGGGCCCAGG + Intergenic
1161989911 19:7678778-7678800 CCCATGGATTTGGGGTTCCCAGG - Intronic
1162309894 19:9900052-9900074 ATCATGGCTTTCTAGGTCCCTGG + Intronic
1163288744 19:16365008-16365030 GCCCTGGGTTTGGGGGTTCCTGG - Intronic
1163514095 19:17752646-17752668 CCCAGCACTTTGGGGGTCCCAGG + Intronic
1165419865 19:35717528-35717550 CCCAGGGCCTCGGGGGTCCCGGG + Intergenic
1166255155 19:41599111-41599133 ACACTGAGTTTGGGGGTCCCAGG + Intronic
1167459014 19:49614667-49614689 ACCAAGGACTTGGGGGCCCCGGG + Intronic
1168215730 19:54924216-54924238 CCCATGGCTTTGGGAGGCCGAGG - Intronic
1168553479 19:57318942-57318964 ACCATGGTGTGAGGGGTCCCCGG + Intergenic
927132823 2:20074907-20074929 ACCATGGCCTTGGGGCTCCGTGG + Intergenic
927468051 2:23351611-23351633 GCCAGGGCTTTGGGGCTTCCTGG - Intergenic
928207673 2:29298159-29298181 ACCAGGGCATTGGGGCCCCCAGG + Intronic
931155593 2:59625089-59625111 GCCACGGATTTGAGGGTCCCGGG + Intergenic
931964919 2:67522710-67522732 ACCATGGCTGTGGGGATTCAGGG + Intergenic
936972414 2:118187987-118188009 GCCATGGCTTCGGGGCTCCAGGG + Intergenic
941207552 2:162592635-162592657 ACAAAGGCTCTGAGGGTCCCTGG - Intronic
942931533 2:181500055-181500077 ACCATGGCTTTGATGGTAGCAGG + Intronic
946074576 2:217063428-217063450 AACAGGGCTTTGGGGGATCCTGG + Intergenic
946305752 2:218856131-218856153 ACCCTGGGTTTCTGGGTCCCTGG - Intergenic
946592211 2:221262971-221262993 ACCTTGGCTGTGGAGGTCACAGG - Intergenic
946691141 2:222309126-222309148 ACAGTGGCTTTGGGAGTCCAAGG - Intergenic
947438424 2:230094096-230094118 ACCATGGCTTTGTGGGAACATGG + Intergenic
947444947 2:230156414-230156436 CCCTTGGCAGTGGGGGTCCCAGG + Intergenic
947741905 2:232488436-232488458 ACCACGGCTCAGGGAGTCCCTGG + Intergenic
947800677 2:232927426-232927448 TCCATGGTTTTGGAGCTCCCGGG + Intronic
947928102 2:233938845-233938867 ATCGCGGCATTGGGGGTCCCAGG - Intronic
948983000 2:241504382-241504404 ACCTTGGCTTTGGGGACTCCTGG - Intronic
1173523176 20:43713831-43713853 ACCCTGGCTTCTGGGGACCCAGG - Intronic
1174419464 20:50390247-50390269 AAAATGGCTTAGGGAGTCCCAGG + Intergenic
1175962313 20:62643202-62643224 GCCGTGGCTTGGGGGGACCCGGG + Exonic
1176100134 20:63361018-63361040 CCTCTGGCTCTGGGGGTCCCAGG + Intronic
1179891068 21:44335356-44335378 GCCAGGACTCTGGGGGTCCCAGG + Intronic
1180255393 21:46624054-46624076 ACTCTGCCTTTGGGGCTCCCTGG + Intergenic
1180788022 22:18557790-18557812 CCCATGGCTTAGGGGCTCCTGGG - Intergenic
1181233716 22:21437528-21437550 CCCATGGCTTAGGGGCTCCTGGG + Intronic
1181244934 22:21497315-21497337 CCCATGGCTTAGGGGCTCCTGGG - Intergenic
1183411065 22:37655373-37655395 GGCAGGGCTTGGGGGGTCCCAGG - Exonic
1183623081 22:38986160-38986182 GCCATGGCTGGGGGTGTCCCAGG + Intronic
1183633092 22:39045289-39045311 GCCATGGCTGGGGGTGTCCCAGG + Intronic
1184333041 22:43838058-43838080 GCCATGGCTTTGGGAGGTCCTGG - Intronic
1184446733 22:44552004-44552026 ACTATGCCTTTGGTGATCCCTGG + Intergenic
1185403856 22:50633921-50633943 TCTTTGGCTTTGGGGGTACCAGG + Intergenic
949361347 3:3235400-3235422 ACCATGGCTTTGGTTTTCTCAGG - Intergenic
950041711 3:9923984-9924006 ACCGGGGTTTTGGGGGGCCCTGG - Exonic
954798424 3:53173251-53173273 ACCTTGGGTTTGGAGCTCCCGGG - Intronic
956621172 3:71222667-71222689 ACCAAGGCTTTGGGAGGCCAAGG - Intronic
959686811 3:109156476-109156498 ACCAGGGCTTTGGGAGGCCAAGG - Intergenic
959755253 3:109889607-109889629 ACTAGGGCTTTGGGCGTCCAAGG - Intergenic
959829179 3:110839913-110839935 ACCATGGCTTTGGAGTATCCAGG - Intergenic
961350241 3:126295880-126295902 ATCAGGGTTTAGGGGGTCCCTGG - Intergenic
965313128 3:167156615-167156637 ACTATGGCTATGAGGATCCCAGG + Intergenic
968464561 4:744103-744125 CCCACGGCTTTGCGGGTCCCAGG + Intronic
968530239 4:1087322-1087344 ACAATGGCATTGGGGGTGGCAGG + Intronic
968540431 4:1165538-1165560 AGCATGGAGCTGGGGGTCCCTGG - Intergenic
968607843 4:1543889-1543911 ACCCTGGCTGTGGGTGTCTCAGG - Intergenic
970913561 4:21307070-21307092 CCCAGGACTTTGGGGGTCCAAGG - Intronic
971248163 4:24949141-24949163 ATCATGCCTTTGGGGTTTCCTGG + Intronic
971422489 4:26486661-26486683 ACCAACGCTTTGGGAGTCCGAGG + Intronic
974204035 4:58675805-58675827 AGCATGGCCAAGGGGGTCCCAGG + Intergenic
976350207 4:84052038-84052060 ACCATGCCTTGTTGGGTCCCCGG - Intergenic
979967042 4:127087645-127087667 AGCATGGCTTTGGAGGCCTCAGG - Intergenic
985614990 5:914883-914905 GAAATGGCTTTGGGGGTCCAGGG + Intronic
985637891 5:1048860-1048882 AGCCTGGTTTTTGGGGTCCCAGG + Intergenic
986446364 5:7824796-7824818 ACCCTGGTTCTGGGCGTCCCTGG + Intronic
989635741 5:43530970-43530992 ACCAGACCTTTGAGGGTCCCAGG - Intronic
994283585 5:97937301-97937323 AACATGGCTGAGGAGGTCCCAGG + Intergenic
994425334 5:99577550-99577572 AACATGACTGGGGGGGTCCCAGG - Intergenic
994436006 5:99734685-99734707 AACATGACTGGGGGGGTCCCAGG + Intergenic
997664143 5:135615003-135615025 AGCATGGCTTGGGAGGTCTCAGG - Intergenic
1001063782 5:168518544-168518566 ACAATGTGTTTGTGGGTCCCAGG + Intronic
1002783011 6:381120-381142 ACCATAGGTTTCGTGGTCCCTGG + Intergenic
1002988739 6:2217792-2217814 TCCAGGGCTTTGGGGGGCACTGG - Intronic
1003303877 6:4909049-4909071 ACCGTGCCTTGGGGGGCCCCAGG + Intronic
1004555659 6:16695093-16695115 ACCATGGCTCTTGGGGACCATGG + Intronic
1006106785 6:31721598-31721620 ACCAGGTCTTTGGGGCCCCCAGG + Intronic
1006190123 6:32202364-32202386 ACCACGGGCTTGGGGGGCCCAGG - Exonic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006603561 6:35241566-35241588 AGCATGGCTTTCGAGGCCCCAGG - Exonic
1007631861 6:43277201-43277223 GCCCTGGCCTTGGGGGTGCCAGG + Intronic
1009449464 6:63784511-63784533 ACCATGGCTGGGGAGGTCTCAGG + Intronic
1010958573 6:82119522-82119544 ACTATGGCTATGGAGGTGCCAGG - Intergenic
1015734242 6:136380833-136380855 CCCTTGGCTTTGGAGGGCCCGGG + Intronic
1016835230 6:148470310-148470332 ACCATGTCTTTGGTGCTCCCAGG - Intronic
1018393584 6:163359671-163359693 ACCATGGCCTTGGAAGTACCAGG + Intergenic
1019157538 6:170049385-170049407 AGCCTGTCTATGGGGGTCCCCGG - Intergenic
1019594146 7:1850635-1850657 ACCATGGCTTTGGGGGTCCCCGG - Intronic
1022171628 7:27837393-27837415 CCCATGGCTTTGGGGCTCAGTGG + Intronic
1023526543 7:41109428-41109450 ATCAGAGCCTTGGGGGTCCCTGG + Intergenic
1026590278 7:71688451-71688473 CCCGAGGCTTTGGGGGACCCAGG + Intronic
1026880106 7:73902371-73902393 ACCAGGAAGTTGGGGGTCCCTGG + Intergenic
1028503103 7:91540842-91540864 CCCATGGCTTTGTGGGGCACAGG + Intergenic
1028676764 7:93473214-93473236 ACCTTCGCTATGGGGGTGCCAGG + Intronic
1029372317 7:100157841-100157863 ACCTTGGCCTTAGGTGTCCCTGG + Exonic
1031238820 7:119211908-119211930 ACCATGGCTTGGGAGGCCTCAGG - Intergenic
1032324814 7:130917343-130917365 ACCATTGCTTTGGGGGGCTGAGG - Intergenic
1033310414 7:140257653-140257675 ACAATGGATTTGGGGGACTCAGG + Intergenic
1034054775 7:148022559-148022581 ACCATGGCTATGGGAGTACCCGG + Intronic
1035094145 7:156340012-156340034 ACCATGGCTTTAGGTCTCCTGGG + Intergenic
1035588594 8:796188-796210 AGCACAGCTTTGGGGGTTCCAGG + Intergenic
1035677989 8:1468422-1468444 ACCATGGCTGTTGGGGACTCAGG - Intergenic
1037778184 8:21849376-21849398 ACTGTGGCTGTGGGGGTCCCGGG - Intergenic
1040595747 8:48835800-48835822 TCCATGGCTTTGGTTGTTCCTGG + Intergenic
1040666360 8:49638913-49638935 ATCAAAGCTTTGGGGGTCTCAGG + Intergenic
1043417931 8:80070674-80070696 ACCTGGGCGTTGGGGATCCCTGG + Intronic
1044728050 8:95208768-95208790 GCCACAGCTTTGGGGGTGCCAGG + Intergenic
1048137959 8:131764750-131764772 ACCATGGCTTTGGGAGGCTGAGG + Intergenic
1048214176 8:132480631-132480653 ATCATGGCATTGGAGTTCCCGGG - Exonic
1049756928 8:144314924-144314946 ACCTTGGCCCTGGGGGTCTCTGG + Exonic
1055234247 9:74100483-74100505 CCCAGCGCTTTGGGGGTCCAAGG - Intergenic
1055914120 9:81382782-81382804 AACATGGCTTTGGAGGCCTCAGG + Intergenic
1056085693 9:83147604-83147626 ACCAGGGCTTTAGGAGTCGCAGG - Intergenic
1057931956 9:99201435-99201457 ACAAAGGCTTTGGGGGGCCATGG - Intergenic
1058544350 9:106044090-106044112 TCCATTGGTTTGGGGGTTCCTGG - Intergenic
1059611232 9:115898763-115898785 AGCATGGCTTGGGAGGTCTCAGG - Intergenic
1061925648 9:133804926-133804948 GCCATGGCTTGGAGGGTTCCCGG - Intronic
1062042649 9:134411258-134411280 CCCCAGGCTTTGGGGGGCCCAGG - Intronic
1062177649 9:135173157-135173179 TCCAGGGCTTTGGGGCTACCAGG + Intergenic
1062287356 9:135779065-135779087 TCCATGGCTGTGGGGGTCTCAGG - Intronic
1062376450 9:136263966-136263988 CCCATGGCCTTGGGCTTCCCTGG + Intergenic
1185477762 X:425457-425479 ACCAGGCCTTTGGGGGGTCCTGG - Intergenic
1185477787 X:425522-425544 ACCAGGCCTTTGGGGGGTCCTGG - Intergenic
1185477812 X:425587-425609 ACCAGGCCTTTGGGGGGTCCTGG - Intergenic
1185769748 X:2756864-2756886 ACTAGGGCTTCGGGGGTCGCAGG - Intronic
1187463335 X:19506772-19506794 ACCAGGGCTTTGGGAGGCCAAGG - Intronic
1192475770 X:71441149-71441171 ACCATGGCTTTGGGAGGCTGAGG - Intronic
1192529954 X:71875304-71875326 CCCTTGGCTTTGTGGGGCCCAGG + Intergenic
1195924651 X:110013329-110013351 ACTATGGCTCTGGGAGTCCTGGG + Intronic
1196613425 X:117739993-117740015 AGGAAGGCTTTGGGGGTTCCTGG - Intergenic
1197112213 X:122789659-122789681 TCCATAGCTGTGGGGGTTCCTGG - Intergenic
1198078454 X:133216279-133216301 ACCATGGCTTTGGACTTCTCAGG - Intergenic
1198083805 X:133264391-133264413 CCCAGGGCTTTGGGAGGCCCAGG + Intergenic