ID: 1019594907

View in Genome Browser
Species Human (GRCh38)
Location 7:1853993-1854015
Sequence CCATTCTCATGCCGTGCACT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019594902_1019594907 -10 Left 1019594902 7:1853980-1854002 CCAGCTCCCGGCGCCATTCTCAT 0: 1
1: 0
2: 2
3: 12
4: 99
Right 1019594907 7:1853993-1854015 CCATTCTCATGCCGTGCACTGGG No data
1019594900_1019594907 0 Left 1019594900 7:1853970-1853992 CCTGCTGCCGCCAGCTCCCGGCG 0: 1
1: 0
2: 0
3: 18
4: 314
Right 1019594907 7:1853993-1854015 CCATTCTCATGCCGTGCACTGGG No data
1019594901_1019594907 -7 Left 1019594901 7:1853977-1853999 CCGCCAGCTCCCGGCGCCATTCT 0: 1
1: 0
2: 1
3: 13
4: 209
Right 1019594907 7:1853993-1854015 CCATTCTCATGCCGTGCACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019594907 Original CRISPR CCATTCTCATGCCGTGCACT GGG Intronic
No off target data available for this crispr