ID: 1019595513

View in Genome Browser
Species Human (GRCh38)
Location 7:1856624-1856646
Sequence AGTTCAGGAGGAGCTGCTCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019595509_1019595513 30 Left 1019595509 7:1856571-1856593 CCTGTATCCGCTGCGTGCTGTGT 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1019595513 7:1856624-1856646 AGTTCAGGAGGAGCTGCTCGCGG No data
1019595510_1019595513 23 Left 1019595510 7:1856578-1856600 CCGCTGCGTGCTGTGTGAGCAGA 0: 1
1: 0
2: 1
3: 4
4: 140
Right 1019595513 7:1856624-1856646 AGTTCAGGAGGAGCTGCTCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019595513 Original CRISPR AGTTCAGGAGGAGCTGCTCG CGG Intronic
No off target data available for this crispr