ID: 1019595914

View in Genome Browser
Species Human (GRCh38)
Location 7:1858328-1858350
Sequence TGTCATGCCCAGAGTGGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 229}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1019595914_1019595924 28 Left 1019595914 7:1858328-1858350 CCTGGCCCACTCTGGGCATGACA 0: 1
1: 0
2: 2
3: 32
4: 229
Right 1019595924 7:1858379-1858401 GGCTCAGCCTCCACCTGGCTTGG 0: 1
1: 0
2: 5
3: 74
4: 1168
1019595914_1019595922 23 Left 1019595914 7:1858328-1858350 CCTGGCCCACTCTGGGCATGACA 0: 1
1: 0
2: 2
3: 32
4: 229
Right 1019595922 7:1858374-1858396 GCCTTGGCTCAGCCTCCACCTGG 0: 1
1: 0
2: 5
3: 37
4: 300
1019595914_1019595921 7 Left 1019595914 7:1858328-1858350 CCTGGCCCACTCTGGGCATGACA 0: 1
1: 0
2: 2
3: 32
4: 229
Right 1019595921 7:1858358-1858380 AATGGCTTTTGTTTTTGCCTTGG 0: 1
1: 0
2: 2
3: 38
4: 449

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1019595914 Original CRISPR TGTCATGCCCAGAGTGGGCC AGG (reversed) Intronic
900182626 1:1319004-1319026 TGAAATGGCCAGAGTGGGACAGG - Intronic
900242680 1:1624502-1624524 GGTCTTGCCGAGGGTGGGCCCGG + Intronic
900283533 1:1888274-1888296 TGTCATCCTCACACTGGGCCTGG + Intronic
900618397 1:3575928-3575950 GGTGAGGCCCGGAGTGGGCCTGG - Intronic
901677702 1:10896529-10896551 TGGCATGCCTAGAGAGGGCATGG - Intergenic
902480494 1:16708856-16708878 GGTCATGCTCATAGTGGCCCTGG - Intergenic
902841049 1:19074077-19074099 TGTCATGTTAAGAGAGGGCCTGG - Intergenic
904053538 1:27655662-27655684 TGCCAGGCCCAGAGTAGGCGCGG + Intergenic
905412092 1:37777718-37777740 TGGCATCCCCAGAGAGGGCATGG - Intergenic
905792410 1:40797239-40797261 AGCCATGCCCAGATTGGGGCAGG - Intronic
906433187 1:45772757-45772779 TGGCATGCCCAGGGAGGGCATGG + Intergenic
907420340 1:54342784-54342806 GGTCCTGCCCAGGGTGTGCCAGG - Intronic
908466689 1:64402974-64402996 TGTCTTTTCCAGAGTGGGCCAGG - Intergenic
908811615 1:67987232-67987254 TGTCATTCCCAGGCTGGGCGGGG - Intergenic
911100157 1:94089056-94089078 TTTCAAGACCAGAGTGTGCCTGG - Intronic
911168232 1:94744238-94744260 TGTCATGTCCAGAGCAGTCCTGG + Intergenic
912336419 1:108866922-108866944 TTTCATTCCCACAGTAGGCCAGG + Intronic
914814296 1:151052188-151052210 TGTCATAACTAGAGTGGGCCAGG + Exonic
914929781 1:151920837-151920859 TGGCATGCCCAGAGAGGGCATGG - Intergenic
915526304 1:156478388-156478410 TGCCATTCCCAGAGTGGTCCGGG - Intronic
916549223 1:165833328-165833350 TGCCATGCCAAGAGTGGGTCTGG - Intronic
916732094 1:167575416-167575438 TAACATGCCCACAGTGGGCCAGG + Intergenic
916741251 1:167649091-167649113 TATCTTGCCCAGAGTGGGGAGGG + Intronic
918926859 1:190797516-190797538 TGTCCTGCCCACTGTGGCCCTGG + Intergenic
920085695 1:203414614-203414636 TTTCCTGCCCTGGGTGGGCCAGG - Intergenic
920421879 1:205840296-205840318 TGTCATCCCCCCAGTGGCCCAGG - Exonic
922619052 1:226979518-226979540 TGACATTCCCTGAATGGGCCGGG - Intronic
922966872 1:229697802-229697824 TTGCATGCCCAGAGAGGGCATGG - Intergenic
923771888 1:236944760-236944782 TGTCAAGTCCAGGTTGGGCCAGG + Intergenic
1064131855 10:12716702-12716724 CATCATGCAGAGAGTGGGCCTGG + Intronic
1064565368 10:16633821-16633843 TGTCCTGCCCTGGGTGGGTCAGG + Intronic
1065176937 10:23086653-23086675 TGTAATCCCCAGTGTGGGACTGG - Intergenic
1066624718 10:37394854-37394876 TGTTATGCCCAGAGTGAATCTGG + Intergenic
1069619230 10:69826236-69826258 TGTCAAGTCCAGGGTGGGGCAGG + Intronic
1069758071 10:70785810-70785832 TGTCATGCAGAGAGAGGGGCTGG - Intergenic
1070163527 10:73880876-73880898 TGGTGTGGCCAGAGTGGGCCAGG + Intergenic
1071518992 10:86317310-86317332 TGTCTTGCTCAGAGTGGGGAAGG - Intronic
1071575917 10:86726213-86726235 TGTCGTGCCAAGTGTGGCCCAGG - Exonic
1071928292 10:90436703-90436725 TGACATGCCCAGGGAGGGCATGG + Intergenic
1072525349 10:96266450-96266472 AGCCATGCCCAGAGTGGGTGAGG + Intronic
1072739746 10:97902258-97902280 TGTCATGCCCACTCTGTGCCAGG - Intronic
1073452119 10:103616265-103616287 TGTCCTGCCCACAGTGGATCTGG + Intronic
1074013058 10:109504226-109504248 TTTCCTGCCCTGGGTGGGCCAGG + Intergenic
1074549321 10:114428055-114428077 TGTCATGCCGAGAGGGGCACAGG - Intergenic
1075132448 10:119751637-119751659 TGTCATTCCAAGTGAGGGCCTGG - Intronic
1075643335 10:124081023-124081045 TCTCATCCCCACAGTGGCCCAGG - Intronic
1076047652 10:127307628-127307650 AGTCCTGCCCTGGGTGGGCCTGG + Intronic
1076399929 10:130175848-130175870 CACCATGCCCACAGTGGGCCTGG - Intronic
1078143738 11:8709378-8709400 TGGCGTGCTCAGAGAGGGCCTGG - Intronic
1079154084 11:17927857-17927879 TGTCATGCCCCAGGTCGGCCTGG - Intronic
1079176192 11:18143571-18143593 TGTAAAGTCCAGAGTGGGCCAGG + Intronic
1079265562 11:18928797-18928819 TGTAAAGTCCAGAGAGGGCCAGG - Intergenic
1079269171 11:18966710-18966732 TGTAAAGTCCAGAGAGGGCCAGG - Intergenic
1080311993 11:30905451-30905473 TGCCATGGCCAGAGAGAGCCTGG + Intronic
1084296526 11:68216018-68216040 TGAGAGGCCCAGGGTGGGCCAGG + Intergenic
1084381940 11:68818143-68818165 TGTCACTGACAGAGTGGGCCAGG - Intronic
1085053649 11:73392199-73392221 TGTGATGCTCAGAGTGGGGGCGG + Exonic
1085309051 11:75505440-75505462 GGTCATGCAGTGAGTGGGCCTGG - Intronic
1089757232 11:120695875-120695897 GGACAAGACCAGAGTGGGCCTGG + Intronic
1089812960 11:121146778-121146800 TAGCATGCACAGAGTGTGCCTGG - Intronic
1090289414 11:125528768-125528790 TGCCATACCCAGAGAGGGCATGG + Intergenic
1090325145 11:125879573-125879595 TGGCATGCTCAGAGAGGGCATGG - Intergenic
1092585547 12:9897724-9897746 GGTCATGCCCACAATGGACCGGG - Intergenic
1092686249 12:11050417-11050439 TTTCCTGCCCTGGGTGGGCCAGG + Intronic
1094067730 12:26379108-26379130 TGCCATGCCCATAATGTGCCAGG - Intronic
1097137739 12:56873129-56873151 TTTTCTGCCCTGAGTGGGCCAGG + Intergenic
1097420668 12:59374888-59374910 AGTCCTGCCCAGAGAGGGCAAGG + Intergenic
1098641119 12:72839336-72839358 TGTTAAGCCAAGAGTGGGGCAGG - Intergenic
1099103433 12:78471639-78471661 TGGCATGCCCAGAGAGGGCATGG + Intergenic
1099957363 12:89363742-89363764 TGTCTTGCCCAGAGTGTGTGTGG - Intergenic
1100410339 12:94311206-94311228 AGGCATGCCCAGAGAGGGCATGG + Intronic
1101762455 12:107670071-107670093 TGTCACGCCAAGAGTTGGCTTGG - Intergenic
1102040954 12:109800493-109800515 GCTCATGGCCAGAGTGGCCCTGG + Intronic
1103703637 12:122860262-122860284 TCTCATGCCCAGGGTGGCCTAGG - Intronic
1103881164 12:124166966-124166988 TTGCCTGCCCAGAGCGGGCCTGG - Intronic
1103942592 12:124509113-124509135 TGGCATGCACGGAGTGGGGCCGG - Intronic
1104714170 12:131005644-131005666 TGTGATGCCCTGGGTGAGCCTGG + Intronic
1104714182 12:131005693-131005715 TGTGATGCCCTGGGTGAGCCTGG + Intronic
1107236113 13:38172939-38172961 TTAGATGCCCACAGTGGGCCAGG + Intergenic
1107443018 13:40445406-40445428 GGTGATGCCCACACTGGGCCAGG - Intergenic
1107516911 13:41138255-41138277 TGTCCTGCCTAGAGAGGGCATGG + Intergenic
1109042090 13:57352070-57352092 TTTCATGACCATAGTGGCCCTGG + Intergenic
1109205412 13:59477791-59477813 TGACATGCCCAGAGTGGGCATGG + Intergenic
1109332016 13:60942007-60942029 TGGCATGCCCAGAGAGGGCATGG - Intergenic
1113321599 13:109237741-109237763 TGACATCCACAGAGTGGGCTTGG - Intergenic
1113611081 13:111645469-111645491 TGCCATGCCCAGCCTGGTCCTGG - Intronic
1113922332 13:113920093-113920115 TGCCATGCCCTGAGTGTGCTGGG + Intergenic
1114707398 14:24741197-24741219 TGGCAGGCCCAGAGTGGGTGTGG - Intergenic
1116882440 14:50184977-50184999 TGGCTTGCCCAGAGAGGGCTTGG + Intronic
1120998493 14:90434775-90434797 TGGCATGCCCAGGCTGGGGCTGG + Intergenic
1121400325 14:93670549-93670571 TGGCATGCCCAGAGAAGGCATGG - Intronic
1122543751 14:102511193-102511215 TGTGAGGCCCAGAGAGGGTCAGG + Intergenic
1122640643 14:103157132-103157154 TGTGCTGCCCACAGTGGGCCGGG - Intergenic
1122982543 14:105198139-105198161 TGCCAAGACCAAAGTGGGCCTGG - Intergenic
1124803061 15:32853819-32853841 GGCCAGGCCCAGAGTGGGCAGGG + Intronic
1127089948 15:55457216-55457238 TGGCATGGCCAGAGTGAGACTGG + Intronic
1128301014 15:66566186-66566208 TGTCAAGCCCAGAAGGGTCCAGG - Intergenic
1129571911 15:76696213-76696235 TGTCTTGGCCAGGGTGCGCCTGG - Intronic
1130566949 15:85004302-85004324 TGTCCTGCTCAGCTTGGGCCTGG - Intronic
1131963140 15:97809893-97809915 TGTAAGGCCCAGAATTGGCCTGG - Intergenic
1133390350 16:5405163-5405185 TGGTGTGCCCAGGGTGGGCCAGG + Intergenic
1134082403 16:11334117-11334139 TGTCATGGCCATGGTGGGGCTGG - Intronic
1135606840 16:23832996-23833018 CTTCATGAGCAGAGTGGGCCTGG + Intergenic
1137626632 16:49912913-49912935 TGTCATGCACAGGGCTGGCCTGG - Intergenic
1138956034 16:61971520-61971542 TGGCGTGCCCAGAGAGGGCAGGG - Intronic
1139590309 16:67929473-67929495 TCTCTTGCCCAGGGTGGGCCTGG + Exonic
1139595355 16:67954604-67954626 GGACATGGCCAGAGTTGGCCAGG + Intronic
1140164816 16:72540260-72540282 TGGCATGCCCAGAGAGTGCATGG + Intergenic
1142112948 16:88341791-88341813 TGCCATGCCCAGTGGGGGCTGGG + Intergenic
1142113513 16:88344645-88344667 TCACAGGCCCAGAGAGGGCCCGG - Intergenic
1143506490 17:7368609-7368631 TGTCATGCCCAGAGAGGGCACGG + Intergenic
1143793412 17:9316564-9316586 TGGCATGCCCAGAGAGTGCATGG + Intronic
1144335547 17:14266001-14266023 TGTCACGCCCAAAGAGGGCAAGG - Intergenic
1146101975 17:29991590-29991612 TTTTCTGCCCAGGGTGGGCCAGG + Intronic
1146878707 17:36431354-36431376 CCTCATGGGCAGAGTGGGCCAGG - Intronic
1148468151 17:47877307-47877329 TGCCATGCCCTGAGAGGGGCTGG + Intergenic
1148713586 17:49699652-49699674 TGTCCTACCCAGGGTGGGCTAGG - Intergenic
1149426594 17:56560582-56560604 TGGCATGCCCAGGGAGGGCATGG + Intergenic
1149979897 17:61302128-61302150 TGGCATGGCAAGAGTGGGACAGG - Intronic
1150364779 17:64572713-64572735 TGGCCTGCCCAGAGAGGGCATGG + Intronic
1151851652 17:76694162-76694184 TGAGCTGCCTAGAGTGGGCCCGG + Intronic
1152354334 17:79799354-79799376 GGGCCTTCCCAGAGTGGGCCGGG + Intronic
1155144550 18:23072267-23072289 TGTCCTGCCCAGACTGAGACGGG - Intergenic
1155761998 18:29579821-29579843 TCTCATGAACAGAGTAGGCCTGG - Intergenic
1158375072 18:56854427-56854449 TGTTATGCCCAGATTGGGCATGG - Intronic
1161461982 19:4402951-4402973 TCTCATCCCCAGCGAGGGCCTGG + Intronic
1162189670 19:8934985-8935007 TGTCTTGGCCACAGTGGGACTGG + Exonic
1162460453 19:10811285-10811307 TGTCAGGCCCGGGGTGGGTCGGG + Intronic
1163596957 19:18225968-18225990 TGTGAGGCCCAGAGTGGGACGGG - Intronic
1163683264 19:18695974-18695996 TGTCAGGCCCTGTGTGTGCCGGG + Intronic
1163712292 19:18853991-18854013 TGTCAGGCCCAGGGTGGGTGTGG - Intronic
1164596211 19:29531936-29531958 TGTCATGCCCAGAGTGACTTTGG - Intronic
1165968789 19:39607515-39607537 TGTCATCCCCAAGGGGGGCCAGG + Intergenic
1166634551 19:44438791-44438813 TGACATGCCCAGAGAGGGCATGG + Intronic
1167723568 19:51195840-51195862 CGTCTGGGCCAGAGTGGGCCCGG + Intergenic
1202714536 1_KI270714v1_random:34764-34786 GGTCATGCTCATAGTGGCCCTGG - Intergenic
927593164 2:24374182-24374204 TGGCATGTCCAGAGAGGGCATGG + Intergenic
928248437 2:29652795-29652817 TGTCACACCCAGAGAGGGCATGG + Intronic
928794285 2:34997510-34997532 TGTCATCACCAGAGTAGGCCAGG + Intergenic
930933754 2:56920682-56920704 TGGCATGCCCAGAGAGGGCATGG + Intergenic
932044974 2:68339345-68339367 TGCCATGCCCAGAGAGGGTCTGG + Intergenic
934915705 2:98299444-98299466 TGTCTTGCCCAGTGTGAGCCGGG + Intronic
935755290 2:106271800-106271822 TGTTGTACCCAGAGAGGGCCTGG - Intergenic
936529632 2:113267105-113267127 TCTCAGGCGCAGAGTGGCCCAGG + Intronic
937127655 2:119484503-119484525 TGTCATACCCAAAGTAGGCTTGG - Intronic
941443134 2:165563699-165563721 TGTTATGCTCAGAGAGTGCCTGG - Intronic
942099420 2:172564545-172564567 TGTCATTCCCACAATGGCCCAGG + Exonic
942821486 2:180120910-180120932 TGGCATGCCCAGAGAGGACGTGG - Intergenic
947527217 2:230886125-230886147 TGACATGGCCAGGGTGGGCAGGG - Intergenic
948767881 2:240232948-240232970 TGTCCTCCCCAGGGTGGGGCTGG + Intergenic
1174773339 20:53321820-53321842 TGTCATGGACAGTGTGGACCCGG + Intronic
1174995900 20:55567956-55567978 TGTCACAACTAGAGTGGGCCAGG + Intergenic
1178321560 21:31610111-31610133 TTTCCTGCCCTGGGTGGGCCAGG + Intergenic
1178981325 21:37267529-37267551 TTTCACGCCCAGAGGGGGCGGGG - Exonic
1179402125 21:41094086-41094108 TGTCAGGGCCAGAATGGGGCGGG + Intergenic
1180037242 21:45256248-45256270 CGTCCTGCCGAGAGAGGGCCTGG - Intergenic
1180800446 22:18629441-18629463 AGTGAGGCCCAGAGTGGGTCAGG + Intergenic
1180815555 22:18787293-18787315 TGTGCTGCACAGAGTGGCCCCGG + Intergenic
1180851681 22:19024998-19025020 AGTGAGGCCCAGAGTGGGTCAGG + Intergenic
1181201745 22:21221628-21221650 TGTGCTGCACAGAGTGGCCCCGG + Intronic
1181221273 22:21365821-21365843 AGTGAGGCCCAGAGTGGGTCAGG - Intergenic
1181431694 22:22885317-22885339 TGTCATACCCACAGAGGGGCTGG + Intronic
1181700011 22:24615343-24615365 TGTGCTGCACAGAGTGGCCCCGG - Intronic
1182907726 22:33952515-33952537 TGACATGCTCAGAGTGGCCCCGG + Intergenic
1183701705 22:39454727-39454749 TGCCCTGCCCAGAGCTGGCCAGG - Intergenic
1184093664 22:42305300-42305322 TGCCATGCCCTGAGGGGGGCAGG - Intronic
1184334173 22:43843692-43843714 TGGCTTGCCCAGAGAGGGCATGG + Intronic
1184366318 22:44053881-44053903 TGGCACGCCCAGAGAGGGCATGG - Intronic
1184415666 22:44350529-44350551 TATTATTCCCAGAGTTGGCCTGG + Intergenic
950828470 3:15850658-15850680 TGGCATCCCCAGAGAGGGCATGG + Intronic
951431129 3:22608318-22608340 TGATATGCCCAGTGAGGGCCCGG + Intergenic
953638604 3:44685000-44685022 TGTAATGCTTAGCGTGGGCCAGG - Intergenic
955392230 3:58530290-58530312 TGACATGCCCAGATGGGGCCAGG + Intronic
955958589 3:64316310-64316332 TGGCGTGCCCAGAGAGGGCATGG + Intronic
957026989 3:75193305-75193327 TGGCATACCCAGAGAGGGCTGGG - Intergenic
957959780 3:87234470-87234492 TTTAATGCCCAGAGTGGAGCCGG + Intronic
960803472 3:121561331-121561353 TAACATGCCCAGGGTTGGCCGGG + Intergenic
960902060 3:122563646-122563668 TCTGAAGCACAGAGTGGGCCTGG - Intronic
960997706 3:123350768-123350790 TGGAATGCCCAGACTGGCCCGGG + Intronic
963726044 3:148922892-148922914 TGGCATGACCAGAGAGGGCATGG + Intergenic
966506122 3:180703652-180703674 TTTTCTGCCCTGAGTGGGCCAGG - Intronic
967275975 3:187774868-187774890 TCACATTCCCAGAGTGGGCCTGG + Intergenic
968661962 4:1802354-1802376 TCTGAGGCCCAGAGGGGGCCTGG - Intronic
969886204 4:10217713-10217735 TGTCATTCCCAGGGTTGGGCTGG + Intergenic
970242714 4:14026072-14026094 TGTCCTGCCCAGAGTCAGCCAGG - Intergenic
971023630 4:22565871-22565893 TGGCATGCCCAGAGAGGGCATGG + Intergenic
972836109 4:42871692-42871714 TGTCCTGTGCAGACTGGGCCTGG + Intergenic
975668341 4:76755236-76755258 TGTCATGCCCCAGGTGGCCCAGG + Intronic
977443791 4:97102435-97102457 TTTTCTGCCCTGAGTGGGCCAGG + Intergenic
979524749 4:121705286-121705308 TGCCATGCCTGGAGAGGGCCTGG - Intergenic
979610835 4:122687209-122687231 TGGCATGCCCAGAGAGAGCCTGG + Intergenic
982099002 4:151950235-151950257 TGTTAAGTCCAGAGTGGCCCAGG + Intergenic
986846684 5:11764399-11764421 AGACATGCCCACAATGGGCCAGG - Intronic
987574591 5:19708610-19708632 TTTTCTGCCCTGAGTGGGCCAGG - Intronic
990523700 5:56604548-56604570 TGTCCTGCAGAGAGTGGCCCGGG - Intronic
992009684 5:72514052-72514074 TGGCATGCCCAGAGAGGACATGG - Intergenic
993936166 5:94005501-94005523 AGATATGCACAGAGTGGGCCAGG - Intronic
994232255 5:97320925-97320947 TGTCATGCCCAGTGAAGGTCTGG - Intergenic
999246713 5:150158908-150158930 TGTCCTGTCCACAGTGGGGCTGG - Intergenic
1002337967 5:178493508-178493530 TGTCATGTGCAGAGTAGGGCAGG - Intronic
1002978658 6:2112037-2112059 CGTCATGGCCAGAGCGGGCGTGG - Intronic
1003122679 6:3330508-3330530 TGTCACTCCCCAAGTGGGCCTGG + Intronic
1003761607 6:9184836-9184858 TTTTCTGCCCTGAGTGGGCCAGG - Intergenic
1004890854 6:20099022-20099044 TGTCATGTCTGGTGTGGGCCTGG - Intergenic
1005310428 6:24553832-24553854 TAGCATGCCCAGAGAGGGCATGG + Intronic
1005746865 6:28846419-28846441 TGGCATGCCCAGGGAGGGCATGG + Intergenic
1006406836 6:33850353-33850375 TGTCTGGCCCAGGGTGGGTCAGG - Intergenic
1006443191 6:34064668-34064690 TGTCATCCCAGGAGAGGGCCTGG - Intronic
1007535879 6:42588289-42588311 TGGCATGCCCAGAGAGGGCATGG - Intronic
1010238130 6:73591960-73591982 TGGCACGCCCAGAGAGGGCATGG - Intergenic
1012377094 6:98575146-98575168 TGTCAGGCCTTGAGTGGGCATGG + Intergenic
1012953309 6:105541622-105541644 TGTTATGCCCAGGGAGGGCATGG + Intergenic
1018394958 6:163370973-163370995 TGTCCTGCCCACACAGGGCCTGG + Intergenic
1018635943 6:165859567-165859589 TGGCGTGCCCAGAGAGGGCAGGG - Intronic
1019595914 7:1858328-1858350 TGTCATGCCCAGAGTGGGCCAGG - Intronic
1021507744 7:21403995-21404017 TGTCATGCCCAAAGAGGGCATGG - Intergenic
1022469084 7:30670932-30670954 TTCCATGCCCAGAGTGGCCCAGG + Intronic
1023547713 7:41336290-41336312 TGTCATGCCCAAAGGGATCCTGG + Intergenic
1023708978 7:42971631-42971653 TGGCATGCCCAGTGAGGGCATGG - Intergenic
1025071320 7:55901655-55901677 TGCCATGCCCAGAGAGGGCATGG + Intronic
1027803201 7:82781890-82781912 TGGCATGCCCAGGGTGGGCATGG + Intronic
1034502917 7:151462588-151462610 TGAGATGCCCACAGGGGGCCTGG + Intergenic
1035290854 7:157837563-157837585 TGTCAAGCCCAGGGTGTTCCTGG - Intronic
1036471091 8:9053430-9053452 TGGCATGCCCAGAGAGGGAATGG + Intronic
1037586013 8:20276506-20276528 TGGCGTGCCCAGAGAGGGCATGG + Intronic
1038428343 8:27479844-27479866 TGTCAAGATCACAGTGGGCCAGG - Intronic
1039536932 8:38324908-38324930 TGGCATGGCCAGAGAGGGCATGG + Intronic
1039597868 8:38807098-38807120 TGGCATTCCCAGAGAGGGCATGG - Intronic
1042096165 8:65218042-65218064 TGGCATCCCCAGAGAGGGCATGG + Intergenic
1043850899 8:85215636-85215658 TGGCATGCCCAGAGAGAGCAGGG + Intronic
1045516526 8:102864600-102864622 TGTGCGGCCTAGAGTGGGCCTGG + Exonic
1045556423 8:103218838-103218860 TGTCTTTCCCAGACTGGGCCAGG - Intronic
1048845434 8:138600462-138600484 TGACATGCTCAGAGTGGGGAGGG + Intronic
1048907491 8:139102481-139102503 TTTCATCCCCAGAGTGAGACAGG + Intergenic
1050599262 9:7234193-7234215 TGGCTTGCCCAGAGGGGGCATGG - Intergenic
1051791334 9:20806084-20806106 TGACATGGCAAGAGTGGTCCAGG - Intronic
1052250843 9:26395349-26395371 TGGCATGCCCTGAGAGGGCATGG - Intergenic
1052974601 9:34401525-34401547 TGCCCTGCACAGGGTGGGCCTGG - Intronic
1054710452 9:68505673-68505695 TGTCTTACCCAGAGAGGGCATGG - Intronic
1055522831 9:77099209-77099231 TGTCATCCCCAGTGTGAGACAGG + Intergenic
1055915242 9:81394014-81394036 TGTCATGCAGAGTGTGGGCCCGG - Intergenic
1056744367 9:89287205-89287227 TGGTATGCCTAGAGAGGGCCTGG + Intergenic
1057051055 9:91924416-91924438 TGTGATTCCCATAGAGGGCCTGG - Intronic
1057590883 9:96372499-96372521 TATCAGGCCCAGAGAGGCCCTGG + Intronic
1057730657 9:97605448-97605470 TGCCATGCCCACAGTGCCCCGGG + Intronic
1058226233 9:102368025-102368047 TTTTCTGCCCAGGGTGGGCCAGG - Intergenic
1058419144 9:104818235-104818257 TTTCATGCCCAGAGTGTCTCTGG + Intronic
1059193535 9:112349257-112349279 TGGCATGCCCAGAGAGGGTATGG + Intergenic
1059284396 9:113160277-113160299 TGGCAAGCCCAGGGAGGGCCTGG - Intronic
1061230236 9:129311767-129311789 AGCCATGCCCAGGGAGGGCCGGG + Intergenic
1061622284 9:131818462-131818484 TGCCGTGCCCAGAGCGGGCATGG + Intergenic
1061903019 9:133682583-133682605 GGTCGTGCCCAAAGTGGGCTTGG + Intronic
1062030573 9:134360146-134360168 TGTCCTGCCTGGGGTGGGCCAGG + Intronic
1062532153 9:137006739-137006761 TCTCCTGCCCACAGTGTGCCAGG + Intergenic
1062711206 9:137976090-137976112 GGCCATGCCCAGTGTGGGCTGGG + Intronic
1187391582 X:18889707-18889729 TGCCATGCCCACTGAGGGCCAGG - Intergenic
1187953747 X:24495634-24495656 TGGTGTGCCCAGAGTGGGCATGG - Intronic
1189472084 X:41322349-41322371 TGTCATGCCCATTGGGGGTCAGG - Intergenic
1189831740 X:44981436-44981458 TGACATGCCCAGAGAGGGCATGG - Intronic
1190756667 X:53407379-53407401 TGGCTTGCCCAGATTGGGCATGG + Intronic
1193787277 X:85774610-85774632 TTTCCTGCCCTGGGTGGGCCAGG + Intergenic
1195942032 X:110174867-110174889 TGTGTTGCCTAGAGTGGGACAGG - Exonic
1196472204 X:116041086-116041108 TTTTCTGCCCTGAGTGGGCCAGG - Intergenic
1201367037 Y:13218699-13218721 TATAATGCCTAGAGTGGGCTGGG + Intergenic